Busch Lab

ZMP

si:ch211-204c21.1

Ensembl ID:
ENSDARG00000053091
ZFIN ID:
ZDB-GENE-030429-35
Description:
Novel protein similar to vertebrate disabled homolog 2, mitogen-responsive phosphoprotein (Drosophil
Human Orthologue:
BDP1
Human Description:
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB [Source:HGNC Sy
Mouse Orthologue:
Bdp1
Mouse Description:
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB Gene [Source:MG

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa6060 Nonsense Mutation detected in F1 DNA Not yet available
sa26556 Nonsense Mutation detected in F1 DNA Not yet available
sa33686 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6060
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122353 None None 636 None 15
ENSDART00000123943 None None 485 None 11
ENSDART00000128763 None None 2342 None 43
ENSDART00000142271 Nonsense 143 491 5 12
ENSDART00000147252 None None 202 None 3
Genomic Location (Zv9):
Chromosome 5 (position 45512076)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43293341
GRCz11 5 43893494
KASP Assay ID:
554-3922.1 (used for ordering genotyping assays)
KASP Sequence:
GGGATGTCACTGACAGCAGAGCTTTCGGCTACGTGTGTGGCGCGGAGGGC[C/T]AGCACCAGTTCTTCGCTATTAAAACAGCACAGCAGGTACAGAGAGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26556
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122353 Nonsense 280 636 3 15
ENSDART00000123943 Nonsense 280 485 4 11
ENSDART00000128763 Nonsense 329 2342 4 43
ENSDART00000142271 None None 491 None 12
ENSDART00000147252 None None 202 None 3
Genomic Location (Zv9):
Chromosome 5 (position 45473255)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43254520
GRCz11 5 43854673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACTTCTAATGCAGCAACGGCGCGGACGGCATAAGCGCGAACATGTCTA[T/A]GAGATGGATCCTGATAAAATGACTTTAGCTGACTTCATTTATTACATCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26555
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122353 Essential Splice Site 325 636 5 15
ENSDART00000123943 None None 485 None 11
ENSDART00000128763 None None 2342 None 43
ENSDART00000142271 None None 491 None 12
ENSDART00000147252 None None 202 None 3
Genomic Location (Zv9):
Chromosome 5 (position 45472864)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43254129
GRCz11 5 43854282
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCCTTGTAAGTCAAATCTAATGTGCAAAGTGAAATTGACTTTGTTTTA[G/T]ATTATTTAAACTTCTGTGCATATTGTGAAGTGGAGCCGGAAGTGTCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33686
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122353 None None 636 None 15
ENSDART00000123943 Nonsense 333 485 6 11
ENSDART00000128763 Nonsense 382 2342 6 43
ENSDART00000142271 None None 491 None 12
ENSDART00000147252 None None 202 None 3
Genomic Location (Zv9):
Chromosome 5 (position 45470265)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43251530
GRCz11 5 43851683
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCTCTCTCTCTCTCTCTCTCAGGGTGCAGAAATACATGGCAGAT[G/T]AGGATGATGATGATGCAGATGATGATATGCTGGTTCCTAAAGTGAGGGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26554
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122353 None None 636 None 15
ENSDART00000123943 None None 485 None 11
ENSDART00000128763 Nonsense 953 2342 18 43
ENSDART00000142271 None None 491 None 12
ENSDART00000147252 None None 202 None 3
Genomic Location (Zv9):
Chromosome 5 (position 45464986)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43246251
GRCz11 5 43846404
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACGAGAGCAGCAAAGGTCAAGCCCGATCTGGCTCCCTCAGAAAGAGAA[C/T]AGATGGAGCAGTTTAAGGCTAGATCAGATTCATCAGCAGAGGACATAAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8203
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122353 None None 636 None 15
ENSDART00000123943 None None 485 None 11
ENSDART00000128763 Nonsense 999 2342 19 43
ENSDART00000142271 None None 491 None 12
ENSDART00000147252 None None 202 None 3
Genomic Location (Zv9):
Chromosome 5 (position 45461747)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43243012
GRCz11 5 43843165
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTAGTGCACCCACTGTTTGTATTTATTTCATTTTTAGGAATATAATTTG[C/T]MGTCTGTGACTTCATCTGAAGYAATTGGTAAGTTTTGTTATATGTAMATG
Associated Phenotype:
Not determined