Busch Lab

ZMP

zgc:113068

Ensembl ID:
ENSDARG00000053082
ZFIN ID:
ZDB-GENE-050320-49
Description:
hypothetical protein LOC541356 [Source:RefSeq peptide;Acc:NP_001013501]
Human Orthologue:
THADA
Human Description:
thyroid adenoma associated [Source:HGNC Symbol;Acc:19217]
Mouse Orthologue:
Thada
Mouse Description:
thyroid adenoma associated Gene [Source:MGI Symbol;Acc:MGI:3039623]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31907 Essential Splice Site Available for shipment Available now
sa24927 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31907
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075054 Essential Splice Site None 364 1 10
ENSDART00000143705 None None 959 None 17
ENSDART00000147371 None None 636 None 9

The following transcripts of ENSDARG00000053082 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8258347)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8560867
GRCz11 13 8892890
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATCTACACGCAGTATTGAACTTTTTTCCATAGGTACTTTGTTACACGG[G/A]TAAGGCAATGTGTTGTACATCAAATTGCAATTAATCTACAATAAAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24927
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075054 Nonsense 121 364 5 10
ENSDART00000143705 Nonsense 97 959 3 17
ENSDART00000147371 None None 636 None 9

The following transcripts of ENSDARG00000053082 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8260570)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8563090
GRCz11 13 8895113
KASP Assay ID:
554-7577.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGCATTGGGTAGTGGTCCAGATTGGCTACAGGAGCAAATGGTTAGATG[T/A]CTGTCTGAGGGTCTGTCTGCTGCTTTCTCCTCTGCAAGCACAGATCAATT
Associated Phenotype:
Not determined