Busch Lab

ZMP

zgc:136839

Ensembl ID:
ENSDARG00000053074
ZFIN ID:
ZDB-GENE-060616-326
Description:
PDZ domain-containing protein GIPC3 [Source:RefSeq peptide;Acc:NP_001038783]
Human Orthologue:
GIPC3
Human Description:
GIPC PDZ domain containing family, member 3 [Source:HGNC Symbol;Acc:18183]
Mouse Orthologue:
Gipc3
Mouse Description:
GIPC PDZ domain containing family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2387006]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa29702 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa3151 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa29702
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075049 Essential Splice Site 220 333 4 7
Genomic Location (Zv9):
Chromosome 22 (position 3303854)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3301168
GRCz11 22 3320436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGATGGTTTGTGTGTGTTTCTCTTTTCTCTGTGTGTTTGTGTGATTCA[G/A]ACATGATCGGTCAGAGGACTCGGGCCCCTAAGTCCAGCGAGGGGAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3151
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075049 Essential Splice Site None 333 6 7
Genomic Location (Zv9):
Chromosome 22 (position 3308168)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3305482
GRCz11 22 3324750
KASP Assay ID:
554-2471.1 (used for ordering genotyping assays)
KASP Sequence:
TCGATGTTTGGGGCGCTTTGGGCGACGTCAAGAATGGACGCCTTTAAAGG[T/C]GAGATCATGAAGGTAGAATTATTGGTAACTAATTTTGTTAACTAAGTCTT
Associated Phenotype:
Not determined