Busch Lab

ZMP

wrn

Ensembl ID:
ENSDARG00000053065
ZFIN ID:
ZDB-GENE-070702-2
Human Orthologue:
WRN
Human Description:
Werner syndrome, RecQ helicase-like [Source:HGNC Symbol;Acc:12791]
Mouse Orthologue:
Wrn
Mouse Description:
Werner syndrome homolog (human) Gene [Source:MGI Symbol;Acc:MGI:109635]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa41585 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34829 Nonsense Mutation detected in F1 DNA Not yet available
sa34828 Nonsense Mutation detected in F1 DNA Not yet available
sa34827 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34826 Nonsense Mutation detected in F1 DNA Not yet available
sa34825 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41585
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074986 Essential Splice Site 257 1387 8 35
ENSDART00000136531 Essential Splice Site 241 1426 9 37
Genomic Location (Zv9):
Chromosome 10 (position 6133990)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7577157
GRCz11 10 7535857
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCATGATTGTTATTATCATATGCTTACATGTTATATATGTGTTTTTGCA[G/A]TGCTGGGAGACTAGTGGATGATCTGTCTCAAACTCTTACATCTCTAAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27551
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074986 Nonsense 362 1387 8 35
ENSDART00000136531 Nonsense 346 1426 9 37
Genomic Location (Zv9):
Chromosome 10 (position 6133676)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7576843
GRCz11 10 7535543
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAACAGGCCAGACAGGAGCAGCTGGAGGAGGAGTGTATCTTAGCTTTC[C/T]AGGTTAGGGCTGCAAAGTATTATGTTTCAGCATCGGCATTGCAATATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34829
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074986 Nonsense 431 1387 11 35
ENSDART00000136531 Nonsense 415 1426 12 37
Genomic Location (Zv9):
Chromosome 10 (position 6130140)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7573307
GRCz11 10 7532007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAATGTCTGTTTCTGTTAAGATTCAAGCATTCCACAGCCAGTTCCTGAA[C/T]AAATCAAATGTCTGAAAATGTTCTTTGGACATCACAGTTTCAAACCGTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27550
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074986 Nonsense 698 1387 18 35
ENSDART00000136531 Nonsense 682 1426 19 37
Genomic Location (Zv9):
Chromosome 10 (position 6117504)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7560671
GRCz11 10 7519371
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAGCTGGACATCCCATGTGGAGTTTATCACGCTGGTCTGAGCATCAAA[C/T]AGAGGAGAGAGACTCAGCACCAGTTCATGAGGGATGAGATTCAGGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34828
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074986 Nonsense 787 1387 20 35
ENSDART00000136531 Nonsense 827 1426 22 37
Genomic Location (Zv9):
Chromosome 10 (position 6113831)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7556998
GRCz11 10 7515698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCAAAGATTCATTCTCAACCAATCCAAAAGTGAGCGCTTCAGGAGTTA[C/A]AAAATAGACATGATGGCAAAAATGGAAAAGTATCTGAATTCAACCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34827
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074986 Essential Splice Site 1167 1387 30 35
ENSDART00000136531 Essential Splice Site 1200 1426 32 37
Genomic Location (Zv9):
Chromosome 10 (position 6098140)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7541307
GRCz11 10 7500007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCATCTCCATCACATACAGCCTTTTCCAGATAGAGCACAAGAGCTTGG[T/C]ACAACATTCACTTCCTAATCCTTACTTTAGCTGTAGTGTTTGTTAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34826
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074986 Nonsense 1341 1387 34 35
ENSDART00000136531 Nonsense 1374 1426 36 37
Genomic Location (Zv9):
Chromosome 10 (position 6091957)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7535124
GRCz11 10 7493824
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGAATGGAGCTGGCTTCCTGGAACCAGGATAACCTGGATAAGGACACA[C/T]AAGATCTCTTCAGCGATTCCCCTGTGAAGGTAGGACAGCTGGTTGAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34825
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074986 Essential Splice Site 1350 1387 34 35
ENSDART00000136531 Essential Splice Site 1383 1426 36 37
Genomic Location (Zv9):
Chromosome 10 (position 6091927)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7535094
GRCz11 10 7493794
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAACCTGGATAAGGACACACAAGATCTCTTCAGCGATTCCCCTGTGAAG[G/A]TAGGACAGCTGGTTGAGTACAGCTGATTTCAACATTGCTCCTAAGAAATG
Associated Phenotype:
Not determined