Busch Lab

ZMP

rnft2

Ensembl ID:
ENSDARG00000053019
ZFIN ID:
ZDB-GENE-050522-168
Description:
RING finger and transmembrane domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001018369]
Human Orthologue:
RNFT2
Human Description:
ring finger protein, transmembrane 2 [Source:HGNC Symbol;Acc:25905]
Mouse Orthologue:
Rnft2
Mouse Description:
ring finger protein, transmembrane 2 Gene [Source:MGI Symbol;Acc:MGI:2442859]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15084 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26413
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074979 Nonsense 2 443 2 11
Genomic Location (Zv9):
Chromosome 5 (position 13030902)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11442305
GRCz11 5 11942522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTCTGCCCAGTTTTGGAGCTCCTGGTGATAAAGCGGGTGCCATG[C/T]AGAGACGCCACAGCAGTAATACTGAGGGCATGCCACCAGAAAGGTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15084
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074979 Essential Splice Site 242 443 6 11
Genomic Location (Zv9):
Chromosome 5 (position 13023742)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11435145
GRCz11 5 11935362
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATTGTGTATGTGTACTATACCTTCAGYACTGAGGAACTTCAYAACAGG[T/C]ACAGGCCCATTCAACAGAGTCTCCATCATAACTGAYTCCATTTTTTATTT
Associated Phenotype:
Not determined