Busch Lab

ZMP

mbnl1

Ensembl ID:
ENSDARG00000052978
ZFIN ID:
ZDB-GENE-060929-704
Description:
muscleblind-like protein 1 isoform 1 [Source:RefSeq peptide;Acc:NP_001070102]
Human Orthologue:
MBNL1
Human Description:
muscleblind-like (Drosophila) [Source:HGNC Symbol;Acc:6923]
Mouse Orthologue:
Mbnl1
Mouse Description:
muscleblind-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1928482]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa5722 Splice Site, Nonsense F2 line generated Not yet available
sa45120 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33021 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5722
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074924 None None 409 None 21
ENSDART00000074929 None None 400 None 14
ENSDART00000098061 Splice Site, Nonsense 160 424 4 18
ENSDART00000124307 Splice Site, Nonsense 160 412 4 17
ENSDART00000126200 None None 118 None 3
Genomic Location (Zv9):
Chromosome 2 (position 47926190)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47948454
GRCz11 2 47802618
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGTCACTTTTAAGTCAGCCACCTTTTGTTTTGCAATAAAATACCTGCA[C/T]GTTTCCCATACTGCTATATTTTACTGCTAAATATTTTAAYATTTTTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45120
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074924 Essential Splice Site 266 409 16 21
ENSDART00000074929 None None 400 None 14
ENSDART00000098061 None None 424 None 18
ENSDART00000124307 None None 412 None 17
ENSDART00000126200 None None 118 None 3
Genomic Location (Zv9):
Chromosome 2 (position 47931346)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47963010
GRCz11 2 47817174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTTTTGTTTTTTCTTTTTAACGTGTTACTTTTGGTCACTTTGTTT[C/T]GTCTGCCAGAAACATTTGAGTAGTGCTTCGCTTGCTTCATTTGCATTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33021
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074924 Essential Splice Site 280 409 16 21
ENSDART00000074929 Splice Site None 400 None 14
ENSDART00000098061 None None 424 None 18
ENSDART00000124307 None None 412 None 17
ENSDART00000126200 None None 118 None 3
Genomic Location (Zv9):
Chromosome 2 (position 47931393)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47963057
GRCz11 2 47817221
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCGTCTGCCAGAAACATTTGAGTAGTGCTTCGCTTGCTTCATTTGCAT[T/G]GAGTTAGCAGTATGGATGTTGTAATGTTAATGACTTTTTTTAATACTCTA
Associated Phenotype:
Not determined