Busch Lab

ZMP

ubin

Ensembl ID:
ENSDARG00000052975
ZFIN ID:
ZDB-GENE-030131-6269
Description:
ubiquilin-4 [Source:RefSeq peptide;Acc:NP_998521]
Human Orthologue:
UBQLN4
Human Description:
ubiquilin 4 [Source:HGNC Symbol;Acc:1237]
Mouse Orthologue:
Ubqln4
Mouse Description:
ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9131 Nonsense Mutation detected in F1 DNA Not yet available
sa15580 Nonsense Available for shipment Available now
sa22943 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9131
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058327 Nonsense 43 497 1 9
ENSDART00000074919 Nonsense 43 599 1 11
ENSDART00000142698 Nonsense 43 497 1 9
Genomic Location (Zv9):
Chromosome 16 (position 49732746)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 46699600
GRCz11 16 46666316
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAGGTTACCGTCAAAACACCGAAGGATAAAGAAGAAATAGCCAWCGCC[G/T]AGGACGCATCTGTCGCACAAGYGAGTTTATTCGCGGTTTCTTGTAGTTTG
Long Flanking Sequence:
CTAAATTTGCTTTGAGTCACTGCCTTGTGGCTGGCTGATTAGAAATTTGCGTTAACAAGCAGTTGGACAGGTGTACCTAATAAAGTGGCCGGTGAGTGTAAGTATTTACACTATTTTCCTTTTTGAAATATAGATTTTTTTATTTACATATATTGTTTACTATATTATTCTTTATTCTCTTGTTTAATCCTTGTTGTTTCATTCATGCATGCGAAATACTTTTCTAGTATACTAAAACTGCACGCTTGTTCTTGTACGGTGAATTCGCGGACACGCCACACCACTAGAGGCCGCTGTGGAACAACCGGCGTTTGCAGCACTTTTCTCCGCTGCTTGTTGGTGCGATGATGTAATGAAGTAAAAGAAGAGTAAAGATGGCGGAGAATAGCGGCACGGATCCTGCCGTGGAGACGAACACTGAAGAAAATGCCGCCGCTAGCGCGACTATCATTAAGGTTACCGTCAAAACACCGAAGGATAAAGAAGAAATAGCCATCGCC[G/T]AGGACGCATCTGTCGCACAAGTGAGTTTATTCGCGGTTTCTTGTAGTTTGTTTCACCCGGGCGTTCATTACACCAGCGGCTAACAGCTTTAGCCGACGAGCTAGCAGTTGACGACGCACAGTCCCAGCCGAAACCAGTCGCCTTGGACATCGAAAACAAATTCATGCTCATGTTATTAGTTAGATGTGGTTATTTTGATCGTGTTATGTGTAGTTTTGTGTTTTTTAAAACCAGTGTAATGTGTGATACTCTAACTCGGCGTTGTCGTTAAACAAACGGCCTGCTCTGGTATAGAAGGTTCTAGTCTGTCATCTTTGGTCGCGCTCTTTCTGTTTTGATTTCTATTGTTGACTTTAGGATCATTCGAGGGATTTAAATAACATGTTAACTGATCTTTTAATCAAAAGGTTGTGTTTATAGTGTTTATGTGCGTTCATTTGACCAACAGCGGTTATATGTTGAGGTCTAAGTTACAATATCAGGTTGAATAAAAGGAACTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28738
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058327 Nonsense 305 497 6 9
ENSDART00000074919 Nonsense 305 599 6 11
ENSDART00000142698 Nonsense 305 497 6 9
Genomic Location (Zv9):
Chromosome 16 (position 49726939)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 46705407
GRCz11 16 46672123
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCATTGTCTTTTGCATAGTTTGGAAATAACCCCTTCTCAGCATTGGGT[G/T]GAAATGGTGAAAACCCCGGAACGCAGCCCTCCAGGACAGAAAACAGAGAG
Long Flanking Sequence:
CTATCTTGTTTATTATTAATATTGTTATTAATATAGTTATTAATTATTTATTTTACCATGTGTATCTATTGCTGTTGATGACTTTTAAATGTTACAATATTTTTATTATATAAAAATATATAATTTATGATGTTCTATGTAAAGTTGCTTTGACACAATCTACATTTGTAAAAGCGCTATAATAAGATAAAGGAAAATTAAATAAAGGAAATTTGAATTGAATTGAATTTTATAATTATAGAAAAGTGGTATTTAAAAATGTGCTAAACTTGATTTGTTTTTTTTTGCCATGACATAGCCAGAGAAGCTGAAATGGCAATAAACTCAAAATCTCTCTCGCTTTTGTGTTCAACAGCAAAAAAAAAACTTAATAGTTTGGGCCATTTTTATTTATGGGTAAACTATCCATTTAACTCTCATTATTAAGTTGCAGCATTATTGATGATATTGCATCATTGTCTTTTGCATAGTTTGGAAATAACCCCTTCTCAGCATTGGGT[G/T]GAAATGGTGAAAACCCCGGAACGCAGCCCTCCAGGACAGAAAACAGAGAGCCTCTGCCAAACCCCTGGGGGCCTCCTGACGGCACCGCTTCCACCACCTCCTCTGGGACGCCCACCACCACCAGCTCCACCACAAGCTCAACCACACCCAGCGTGTCCAATCCTCTGGGCATTAGCTCCTCTAACCTTGGAAACGGTAGCAGCTTTTTATGTCAACATTTGCATTTAAATTTAAAGCAAGTTGCATGAGGTGGATTGAGGCTGTGTTGTAGATAAGTTTTTAGTTTTAACAACTTTATTAATCCCTCTAGGGGCAAGTAAATTAGGGCAGTAGCATCAACAAACACATAAAGAGGCAAATCACTAACAAACAATATTAAAAAACACAATCCAGCATGCCTCATAATAGTACTAAAATAACATGGGAAGGACCCATATAGTAAAAATGTAAAACTTGCTAAAATGTAAGGTTATAAAGGCTTATTGCCTCAGGAACGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15580
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058327 None None 497 None 9
ENSDART00000074919 Nonsense 415 599 7 11
ENSDART00000142698 Nonsense 415 497 7 9
Genomic Location (Zv9):
Chromosome 16 (position 49725867)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 46706479
GRCz11 16 46673195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATATGCGCACCATGATGCAATCCCTSGCCCAGAATCCTGATGTTGYCT[C/A]ACAGGTAGCCGGACAATAATTTAAAAGCTCCCTGGTGTTTTCAGATTTCT
Long Flanking Sequence:
AGCTTCAGAGGATTAGAATCATCTGCTATCACACTTTGAATTGTTTTTATCATTTGTTGTTCCTTGTAAACCAATAGTCTTGGAGCAAGTCTTGAGTTTTGAAGGCGATTTTTGTCTCTAACTGAAAGTGAGGAGAACCAGCATTAAAGAAAAAGCTGAATATTCTCTTAATATAGGTAGTATTAATAACTAATCAGTATTAAAAACTACTCCGCATATATTTTTTTGTCTACAAAAAGAGTTCAGTTTCCTGAGAATTTGCAAGCAAATAATGTTAATGCACAGATTTGAGTGATTTTGTTCAATATAATATGACTTTTTATAATTTCAACTGGCTTAATTTCATGTTTATTTTTTGTGCTTAGGTATGTTTAACAGTCCTGGCATGCAAAGCCTAATGCAACAGATCTCGGAGAACCCTCAGCTTATGCAGAACATGATTTCTGCTCCTTATATGCGCACCATGATGCAATCCCTGGCCCAGAATCCTGATGTTGCCT[C/A]ACAGGTAGCCGGACAATAATTTAAAAGCTCCCTGGTGTTTTCAGATTTCTTTACTATTAAGTTCTAAAATGTGTTTTTTTCTTTCTAGGTATTGATGAACAACCCTCTCTTTGCGGGAAATCCACAACTGCAAGAGCAGATGAGACAGCAGCTACCTGTATTTCTACAGCAGGTGTGTCCAGCTGGAATCTTTGTGACTTCATTTAGATTATGTAATTTCACCTGGTAACTTTTGTTCTATTTCACTGGCAGATGCAGAACCCAGAAGCCCTTTCTGTCATGACAAATCCTCGAGCCATGAGAGCCCTAATGCAGATCCAGGAGGGACTGCAAACCCTTCAAACTGAAGCCCCTGGACTTATGCCCGGGTGCAGTTTCTCATTTTCTCTCATAGAAAAGTGGATTTGCAGAAGTATGCGGAAGGACTTTTAATTTGTCAGCAACTAGGGTTAAGCGCTTCCGGTGAATTGTATCCCATTACAAAATCTGCACGTTTAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22943
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058327 Essential Splice Site 447 497 None 9
ENSDART00000074919 Essential Splice Site 549 599 None 11
ENSDART00000142698 Essential Splice Site 447 497 None 9
Genomic Location (Zv9):
Chromosome 16 (position 49723379)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 46708967
GRCz11 16 46675683
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGCTCATGCAGCAGATGCTACAGATGTTTGCTGGAGGGAGCGCATCGG[T/C]ACTCATGTTTTAATCTTTTTGCTAATAGCAGTTGTCAACAGTATTAATAG
Long Flanking Sequence:
AAGCACATGGTTTTATGAGGTGTGCATAATTTAGGTTAAAGCTAAACTGTGCAGAGCTGTGGCCCTCCAGAATCTGAGTGTGACACCCGTGTACTAAATGAATCAATATTTTAAGTATGTATATAGATAGTCAAATGTTTTGAGATGCTTTAGGCATAATACTTTTATCTAGACATTAAATCTAGATCACATTGCCCTAATTTTAATAAAGAAATTAAAAGTAAACAATATCCTCTTTAAGAGTTATTTCCCTCCTTTGTCGGGCTGAATCTCCAATTAAATCTTTCTGTATCTTTCTAGTCTGGGGCCTGGAGGAATGCCTGGTGGGATTCCCGTTGGTATGCCTGGTGCCCCACTGCCCACAGGAGTGACTGTGACACCTGAGAATCCTCCGCCTTCCAGCCAGGGCTCCACCCCAACCCCGACTGCTGGAGCCAGTCCTGCCCAGCAGCAGCTCATGCAGCAGATGCTACAGATGTTTGCTGGAGGGAGCGCATCGG[T/C]ACTCATGTTTTAATCTTTTTGCTAATAGCAGTTGTCAACAGTATTAATAGTATTTTTATAAAGCTGTCCTTTTTATCTTCAGTTTTATTTTTTAATGGTTATGTTTGAGGTGCAGGTCATTTTAGTATTTAATGGAGCCTATTCTTCTAGTTGTGACATGAATCTGAAGTCGCACAAATACTTGAGTCATTTTAATTGTGATTGCTTGCTGTAGCTCATACGGCATGTGCATAGAATGTGTTTTAATCAAATTGATTCACATTTGAATTGGTTTGAATTCTACATTTCTGGCTACCTGCTAGTTTTGGTTTGCTCTAAATAAATGTTAGGCTTGTCAAGTTATTTCTAGTGAATAGAATAACTCTGCAACTGTCTTGTTAAATTATGTGATAAATCGTATATATTGTAGGGTTGATACTATACTGGAATTTGGTACCAATCGATACTGAAATCTTAAAAACGTCCATTTCTCGCTAACATTTGAGCGCTGTTGAGCATGT
Associated Phenotype:
Not determined