Busch Lab

ZMP

plcd3a

Ensembl ID:
ENSDARG00000052957
ZFIN ID:
ZDB-GENE-070620-1
Description:
1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase delta-3-A [Source:UniProtKB/Swiss-Prot;Acc
Human Orthologue:
PLCD3
Human Description:
phospholipase C, delta 3 [Source:HGNC Symbol;Acc:9061]
Mouse Orthologue:
Plcd3
Mouse Description:
phospholipase C, delta 3 Gene [Source:MGI Symbol;Acc:MGI:107451]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa44568 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20090 Nonsense Available for shipment Available now
sa40128 Nonsense Mutation detected in F1 DNA Not yet available
sa33259 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44568
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102674 Essential Splice Site 30 784 1 15
Genomic Location (Zv9):
Chromosome 3 (position 39299600)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39162960
GRCz11 3 39304818
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTCCAAATCGGTGGAGTCGAAAACTCACGATCCGCTGCGGAGGCTTGG[T/C]GAGTTTTGTCTTACTTCAGGACAAGTGTGTTTTTAAAAGTTACTTGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20090
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102674 Nonsense 134 784 3 15
Genomic Location (Zv9):
Chromosome 3 (position 39275863)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39139223
GRCz11 3 39281081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTGGTTTTCCGTGGAGGAAGGAAAAGCCTGGATCTGTGCTGCCACACA[C/T]AAGAGGAAGCGGAGCGCTGGGTCCGAGGCATCCGCACACTAAAAGACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40128
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102674 Nonsense 158 784 3 15
Genomic Location (Zv9):
Chromosome 3 (position 39275791)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39139151
GRCz11 3 39281009
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGAGGCATCCGCACACTAAAAGACCGCGTCTCCAACATGAGCCAGAAA[G/T]AGAAGCTCGACCAATATCCTTATTAAATAATAACAATACAATAAGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33259
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102674 Nonsense 201 784 4 15
Genomic Location (Zv9):
Chromosome 3 (position 39273238)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39136598
GRCz11 3 39278456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAACATCTGCTCCAGCTGATTAACATTGACCTAAATGAGCAGTACGCA[C/T]GAACGCTCTTCAAGGTTTGTGTGACAGCAGCCGATGCCATAAACAACATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2095
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102674 Nonsense 507 784 10 15
Genomic Location (Zv9):
Chromosome 3 (position 39263875)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39127235
GRCz11 3 39269093
KASP Assay ID:
554-2654.1 (used for ordering genotyping assays)
KASP Sequence:
CATGTATTTCTCTTCATAGTCTGCGAGCACTAAACTGAGTCCAGAGCTGT[C/A]GGATCTGGTGGTGTATTGTCAGAGTGTGCCCTTCAGTGGATTCGAGACAG
Associated Phenotype:
Not determined