Busch Lab

ZMP

NP_001122213.1

Ensembl ID:
ENSDARG00000052948
Description:
hypothetical protein LOC567953 [Source:RefSeq peptide;Acc:NP_001122213]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa41297 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41297
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074900 Nonsense 65 128 2 2
Genomic Location (Zv9):
Chromosome 8 (position 50762562)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 48614972
GRCz11 8 48603741
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTGATGGAGCAGAAGGATGCTACAGCTGAGAAGAGCGCGCTGGACGAG[C/T]GAGCGGAGCAACTGTGGGAGTCGGACGCGCGAAACTCCGCGCTGGCGGGG
Associated Phenotype:
Not determined