Busch Lab

ZMP

aspg

Ensembl ID:
ENSDARG00000052942
ZFIN ID:
ZDB-GENE-070820-14
Description:
asparaginase homolog [Source:RefSeq peptide;Acc:NP_001096091]
Human Orthologue:
ASPG
Human Description:
asparaginase homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20123]
Mouse Orthologue:
Aspg
Mouse Description:
asparaginase homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2144822]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17418 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17418
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074875 Nonsense 181 626 4 16
ENSDART00000109525 Nonsense 203 665 4 18
ENSDART00000135073 Nonsense 203 648 4 16
ENSDART00000143525 Nonsense 215 289 5 7
ENSDART00000145882 None None 74 None 4

The following transcripts of ENSDARG00000052942 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 45916187)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45765419
GRCz11 17 45748671
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAYGGTACAGACACTATGGCTTACACCGCATCTGCCTTATCCTTCATGTG[T/A]GARARCCTKGGGAAGCCRGTCATCCTCACWGGATCACAGGTAAMCTAYAA
Long Flanking Sequence:
TGTTTGGGAAATTATTTATGAGCTTTAAATCACAAAAATTGCACAAAAACATTAGTCATTATAAGAACTGATCTTGATTTAAATGATTGAAAATTATACAAATTTTCAGATTGATTAATAAAATCATATATTTTGGTAAGAGTTTACGATACAGGACACAATTAATGTTAATGTATTTTCTAACATAAACAAATAAACGTATTCATGTTTTTTAAAGTTAGTGAAAATAAAGTTGTTCATTGTTCATGTTAACCCACGTTGCATTAACTTACAACAAGCTCAGCTTTGGATTTTAACAATGTGTTAGTAAATGTTTAGCCATAATTAATAAATACTGTACAACAATTGTTCATTGTTTGTTCATGTTAGTAAATAGGTTACCTACATGTCTCTTTTTCTTCCTTGTGTTCACAGAAACACTATGAGCAATATGATGGTTTCGTCATCCTGCACGGTACAGACACTATGGCTTACACCGCATCTGCCTTATCCTTCATGTG[T/A]GAAAACCTGGGGAAGCCAGTCATCCTCACTGGATCACAGGTAAACTATAAATCATTGACTCGCCCTTGTGTTAAAAATAAAAACCCCTATGACTTTCTTTTCATGAGCACAAATTGAGTAGACCTAAGGCATGGTTACACATAATTCGCTCTTTTGGTTTGTTCGCTTAGCATTTTTACTGTCATTTTAAAAGTAGAACCAAATGAAACCAAAAAATAAAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAAATAACTTGTTTTATTATGCAGATACAGTTACAAAATAATTAGCTTTCTTGTGAAATTTTGCATTATTTTTCAAGCTTATCTCACGAAACTATTTACACAAATTTTCAAACCTAGTAGTTTTAAAAACTATTTTCTAATAAATAATTTCAATATGCTATTATTCAGCTTAAAGTGTAATGGGGTATATGCTGAAGCATGCTAATAGGACTTTTAATTTGCCAGTAACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28926
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074875 Nonsense 597 626 15 16
ENSDART00000109525 Nonsense 619 665 15 18
ENSDART00000135073 Nonsense 619 648 15 16
ENSDART00000143525 None None 289 None 7
ENSDART00000145882 Nonsense 36 74 2 4

The following transcripts of ENSDARG00000052942 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 45933653)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45782885
GRCz11 17 45766137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGTTGAATGAATGTACTTCTGTCTCCTTTAGGCAAGAGCCACTGGATG[T/A]GTGGAGTCTGTTGAGTTCTTAAAACAGGCAGCTCTGTACCAAACTCAGGT
Long Flanking Sequence:
AAAATAATATTAACCAAAACCAATAACATTACACATAAAACAATTGCACATAAAATATTTCAAGTAATAAAGTGATACAACACTCATTTAAAAAACAATGATATTGCACTAAAAATATACAGTGCAAATCTACACGCTAAAACCCGTAATAAGTAAATATACTGCACGAGCAGCAAGGCATTGCATAGATTACTGTAAGGGTAAGTGACTGAGGGAGACGTTATGAAGTCTGATAGCAGTGGGAAGGAAGGATTTTCTGTGGCGTTCAGTGGAACACTTTAAGCTGGTAAGTCTGTGACTAAAGGTACTTCTCAGCTCGTCAACCACATTATGAAGAGGATGATCTACATTGTACATAATTGACCGAAGTCTGCACAATGTTCTCCTTTCAGCCACTTCATCAAAGTTGTCCGAAAACTATTAAACAGAACCTTGCAAAAGTATTCCTGTAAAGTTGAATGAATGTACTTCTGTCTCCTTTAGGCAAGAGCCACTGGATG[T/A]GTGGAGTCTGTTGAGTTCTTAAAACAGGCAGCTCTGTACCAAACTCAGGTATGGAACATATCACTCGTTTCTATATATCAATTTATTTAAAAATAGTAAATTGCCTATATTTGCATAAGGCCCATTCACACTGAGCATGTTTTTTTTTTTGTGATGAGAGGTGGCTATTTTGAATGGTTTTGGCCCTGCGCACCTCACGTTTTAACCGTCTACTGTTTCTAGTGTTTTTGCCAATACGCTCTGTGCGCCTGCTGTGGAAAAAAACGTCAGTTGAGTCTTTTTCAATCCTAAACAAAATGAAAGCAAAGTTTTCATCGAGGTTTACTGTAGGGGTTGTGTTGACGCTATTTGACTTTCGATCTGGAGCTGACAAATTGTGAATATTATATAAATAAAATGAATAAAAAATTGAACAATATTACTAAAAAGCAGCAGGCCTGGAAACTAGTGATTCTGGCATTGGAGATGACAGGTAAGCATCACATCATAAAGTTCCTCTC
Associated Phenotype:
Not determined