Busch Lab

ZMP

tpra

Ensembl ID:
ENSDARG00000052914
ZFIN ID:
ZDB-GENE-081104-2
Description:
Novel protein similar to vertebrate translocated promoter region (To activated MET oncogene) (TPR) [
Human Orthologue:
TPR
Human Description:
translocated promoter region (to activated MET oncogene) [Source:HGNC Symbol;Acc:12017]
Mouse Orthologue:
Tpr
Mouse Description:
translocated promoter region Gene [Source:MGI Symbol;Acc:MGI:1922066]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa10563 Nonsense Available for shipment Available now
sa32892 Nonsense Mutation detected in F1 DNA Not yet available
sa32891 Nonsense Available for shipment Available now
sa19727 Nonsense Available for shipment Available now
sa25104 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32890 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10563
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144 None None 366 None 11
ENSDART00000074850 None None 1309 None 28
ENSDART00000111541 Nonsense 92 1274 3 28
ENSDART00000142968 None None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20660889)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21206827
GRCz11 2 20864889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAACATGATTGCGTGTGTTTTGATTGTTAAGTGGAAGAGCTTAAGAAGT[T/G]AAAAGAGATAGAAGAAGTGCAGGGAACAAYGCAAGAGGTAACTATTTGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2072
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144 None None 366 None 11
ENSDART00000074850 None None 1309 None 28
ENSDART00000111541 Essential Splice Site 171 1274 5 28
ENSDART00000142968 None None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20660233)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21206171
GRCz11 2 20864233
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTCCAGCTTAAACTAGATGAACTTCAGTCTTCTGARGTTTCCATTCAG[G/A]TAAGCAGGGACTTTCATTCAGCTCTGTCTACAACAAATTAAAGGCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32892
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144 None None 366 None 11
ENSDART00000074850 None None 1309 None 28
ENSDART00000111541 Nonsense 179 1274 6 28
ENSDART00000142968 None None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20659360)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21205298
GRCz11 2 20863360
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAAATGGTGTACTTCACTTTGTTTCAGTATCGTGAGAAGCGGATGGAA[C/T]AAGAAAAAGAGCTTCTCCAGAACCAGAACACATGGCTGAACACAGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32891
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144 None None 366 None 11
ENSDART00000074850 None None 1309 None 28
ENSDART00000111541 Nonsense 283 1274 8 28
ENSDART00000142968 None None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20658881)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21204819
GRCz11 2 20862881
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAAGTACCGCAATGAGCTGAATGCAAACCTCAAACTATGTAATTTGTA[C/A]AAGGTCAGTTAAACATTTATTTATTTATTTATTTTATTGACTTGCTGATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25795
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144 None None 366 None 11
ENSDART00000074850 None None 1309 None 28
ENSDART00000111541 Essential Splice Site 392 1274 11 28
ENSDART00000142968 None None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20657303)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21203241
GRCz11 2 20861303
KASP Assay ID:
2259-1858.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGCGGCAGTGGCCAAGATCGTGAAGCCGGGCATGAAGCTAATGGAGG[T/A]ATAAAAGATGTTTAACCACAGGCTAAGGCTGCATTTCAGCCCAATTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19727
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144 None None 366 None 11
ENSDART00000074850 None None 1309 None 28
ENSDART00000111541 Nonsense 439 1274 12 28
ENSDART00000142968 None None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20645256)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21191194
GRCz11 2 20849256
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAGGTGGAAACCAAAGCTCCCATCCTGAAACGCCAGAGAGAGGAATA[T/G]GAGAGCATGCAGAAGTCTATGACCAGTCTCTGTTATAAACTAGAGCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25104
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144 None None 366 None 11
ENSDART00000074850 None None 1309 None 28
ENSDART00000111541 Essential Splice Site 458 1274 12 28
ENSDART00000142968 None None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20645198)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21191136
GRCz11 2 20849198
KASP Assay ID:
554-7472.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGAAGTCTATGACCAGTCTCTGTTATAAACTAGAGCAAGCTATGAAG[G/A]TTTGCACACATTTGAGAGCTAATGCAAAAAGAAGGAACAGGATAATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32890
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144 None None 366 None 11
ENSDART00000074850 Nonsense 877 1309 17 28
ENSDART00000111541 None None 1274 None 28
ENSDART00000142968 None None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20596879)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21166302
GRCz11 2 20824364
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCAACCCTCTGAGTCTCAGATCAGTGGACAGGACTCATCAGAAGAGTA[C/A]AAGCATGATGTAATCGTCATCGAAACAGACAGCGCCACTGAGGAGGAGGA
Associated Phenotype:
Not determined