Busch Lab

ZMP

WNT8A_DANRE

Ensembl ID:
ENSDARG00000052910
Description:
Protein Wnt-8a [Source:UniProtKB/Swiss-Prot;Acc:P51028]
Human Orthologue:
WNT8A
Human Description:
wingless-type MMTV integration site family, member 8A [Source:HGNC Symbol;Acc:12788]
Mouse Orthologue:
Wnt8a
Mouse Description:
wingless-related MMTV integration site 8A Gene [Source:MGI Symbol;Acc:MGI:107924]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35723 Essential Splice Site Available for shipment Available now
sa44812 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4568
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017635 Essential Splice Site None 359 None 7
ENSDART00000132193 Essential Splice Site 8 387 None 7
ENSDART00000144301 None None 264 1 6
ENSDART00000148044 None None 161 None 6
ENSDART00000017635 Essential Splice Site None 359 None 7
ENSDART00000132193 Essential Splice Site 8 387 None 7
ENSDART00000144301 None None 264 1 6
ENSDART00000148044 None None 161 None 6

The following transcripts of ENSDARG00000052910 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 35622725)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34152002
GRCz11 14 34492316
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTCAAGCAGTCAGTCACTTGTCGTCTRTCTCTTGTGCGTATCCATCTC[A/T]GTGTTTGTGCTTTGCATCTCAAGAAGAAGGGAGGATCGAGCAATCACTGG
Long Flanking Sequence:
GAGATCAAAGCTATTCTGATGCAAAAATGCATGTCCAGTATGCATGTCCAGTGCGGAATCAACAATCTGCCCATTCATGAATACACTACACCATCAACGGCTAAGCCTAATGAATGATTATTAATTAAACAGTCGATGCCTTTTGGACAGTTCAATTCAATCTGTCTCCACAAACGTTAGCGCATTAAATAACTTTTTTATGCAAGTAGGCATTCAAATAATGTTTAATTTTTAAACATTTGTCGAAAATCATACTAAAACATAACATCCCCAGGAAATATATAGTTTAATGAAAATAGACTTACGGGCATAGTGAAAAGTGATAATGCTTTGAAGTGCAATTAAGGCAGAACAATTTCACCGTCGACCTCGAGGTCTTTTCACAGCGAATTGTCAAAGCTTGGGAGATCCCTGTCACTCAAAGTTGGCGACAGGTATAAATGCCTTGCTTATTCAAGCAGTCAGTCACTTGTCGTCTGTCTCTTGTGCGTATCCATCTC[A/T]GTGTTTGTGCTTTGCATCTCAAGAAGAAGGGAGGATCGAGCAATCACTGGTCACTCACGCAGCAATGAACCCTTGCCAGATTTTTGCGTCGTTGGTTATGTCTATATGCTGTCACATACTGTCGTCAACAGCATGGTACAGTCATATTTCATATATTTTTATTTATTACTATTATTTTATTTATGACATTTTTAAATTTGACTTAACCCATGTTGACCTCATGCTTCCTTTTATTCTGTTTTTGCTACACGTAGGTCTGTGAATAACTTCCTGATGACAGGACCAAAGGTAATTACATTTTTTACACCTAAATTCTTGCAGAGCAATTTGTTATTTTATCTTTACATAAAAAATGTCTAAAACGTATACATGTCTAATCAAAGCTCATATTTTACATAAATCAGGCTTATCTCGCATACACCAGCAGTGTACAAGCTGGGGCTCAGAGTGGTATAGAAGAGTGCAAGCATCAGTTCGCATGGGACAGGTGGAACTGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35723
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017635 Essential Splice Site None 359 None 7
ENSDART00000132193 Essential Splice Site 8 387 None 7
ENSDART00000144301 None None 264 1 6
ENSDART00000148044 None None 161 None 6
ENSDART00000017635 Essential Splice Site None 359 None 7
ENSDART00000132193 Essential Splice Site 8 387 None 7
ENSDART00000144301 None None 264 1 6
ENSDART00000148044 None None 161 None 6

The following transcripts of ENSDARG00000052910 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 35622725)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34152002
GRCz11 14 34492316
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTCAAGCAGTCAGTCACTTGTCGTCTGTCTCTTGTGCGTATCCATCTC[A/G]GTGTTTGTGCTTTGCATCTCAAGAAGAAGGGAGGATCGAGCAATCACTGG
Long Flanking Sequence:
GAGATCAAAGCTATTCTGATGCAAAAATGCATGTCCAGTATGCATGTCCAGTGCGGAATCAACAATCTGCCCATTCATGAATACACTACACCATCAACGGCTAAGCCTAATGAATGATTATTAATTAAACAGTCGATGCCTTTTGGACAGTTCAATTCAATCTGTCTCCACAAACGTTAGCGCATTAAATAACTTTTTTATGCAAGTAGGCATTCAAATAATGTTTAATTTTTAAACATTTGTCGAAAATCATACTAAAACATAACATCCCCAGGAAATATATAGTTTAATGAAAATAGACTTACGGGCATAGTGAAAAGTGATAATGCTTTGAAGTGCAATTAAGGCAGAACAATTTCACCGTCGACCTCGAGGTCTTTTCACAGCGAATTGTCAAAGCTTGGGAGATCCCTGTCACTCAAAGTTGGCGACAGGTATAAATGCCTTGCTTATTCAAGCAGTCAGTCACTTGTCGTCTGTCTCTTGTGCGTATCCATCTC[A/G]GTGTTTGTGCTTTGCATCTCAAGAAGAAGGGAGGATCGAGCAATCACTGGTCACTCACGCAGCAATGAACCCTTGCCAGATTTTTGCGTCGTTGGTTATGTCTATATGCTGTCACATACTGTCGTCAACAGCATGGTACAGTCATATTTCATATATTTTTATTTATTACTATTATTTTATTTATGACATTTTTAAATTTGACTTAACCCATGTTGACCTCATGCTTCCTTTTATTCTGTTTTTGCTACACGTAGGTCTGTGAATAACTTCCTGATGACAGGACCAAAGGTAATTACATTTTTTACACCTAAATTCTTGCAGAGCAATTTGTTATTTTATCTTTACATAAAAAATGTCTAAAACGTATACATGTCTAATCAAAGCTCATATTTTACATAAATCAGGCTTATCTCGCATACACCAGCAGTGTACAAGCTGGGGCTCAGAGTGGTATAGAAGAGTGCAAGCATCAGTTCGCATGGGACAGGTGGAACTGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44812
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017635 Nonsense 212 359 7 7
ENSDART00000132193 Nonsense 240 387 7 7
ENSDART00000144301 Nonsense 212 263 6 6
ENSDART00000148044 None None 161 None 6

The following transcripts of ENSDARG00000052910 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 35624425)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34153702
GRCz11 14 34494016
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGATGCAGCTTGCTGATTTCAGAGATATCGGCTCCTACCTAAAAATC[A/T]AGCATGATCAAGCACGGAAGTTGGAGATGGATAAAATTCGGATGAGGGCA
Long Flanking Sequence:
AAAAACTGCAGCATGGGGGACTTCGAAAACTGTGGCTGTGACGACTCCAAGATCGGAAAAATGGGTAAGATAAATGTATGATTATTATTATTAATATTATTATTATTAAGTTTTCACACCAATAACGTGAAACTTTTTATATTTCGAAGGTGGTCGTGGTTGGGTTTGGGGAGGTTGCAGTGACAATGTTAACTTTGGAGACAGAATTGCTAAACTATTTGTAGACGCGCTGGAAAATGGTCACGACTCTCGCGCCGCGGTCAACCTGCATAACAACGAAGCTGGTCGACTTGTAAGTACCTATGAGTTTGTTCATTTTCTTTACTTTAACGACATGACTCGTTTTTATAACGCATGTGCATATTTCTGATGTATTTTAGGCTGTTAAAGCAACACTCAAAAGGACCTGTAAGTGTCATGGTTTGTCTGGAAGCTGTAGTATTCAGACATGCTGGATGCAGCTTGCTGATTTCAGAGATATCGGCTCCTACCTAAAAATC[A/T]AGCATGATCAAGCACGGAAGTTGGAGATGGATAAAATTCGGATGAGGGCAGGCAATAGCGCGGACAACCGTGGCGCAATAGCGGACACGTTCAGCGCAGTTGCGCGCACAGAACTCATTTTTATGGAAGATTCACCTGATTACTGCGTGAAAAACCTCAGCATGGGACTACATGGAACTGAAGGCAGGGAATGTCTACAAAGCGGGAAGAATCTTTCTCAATGGGAGAGAAGAAGCTGCAGGCGGCTATGCCACGAATGTGGCCTGAAAGTAGAAGAGAGGAGGATTGAGACAGTGAGCAGCTGTAACTGTAAATTTCACTGGTGCTGCACAGTCAAATGCGAAACATGCACTCAAACCGTTACCAGGTATTTTTGCGCAAAAAGGCACAGAAATCGCCGGCCGCACAACCATTCACGCAAAAGACAACACACGCGTCGTGGATGAAGTAATCCTCTTTGCAAATATGTAAAGCTGTATATTTCTAATGTAAATATATTT
Associated Phenotype:
Not determined