Busch Lab

ZMP

si:dkey-165i4.1

Ensembl ID:
ENSDARG00000052897
ZFIN ID:
ZDB-GENE-060526-217
Description:
ataxin-2 [Source:RefSeq peptide;Acc:NP_001121821]
Human Orthologue:
ATXN2
Human Description:
ataxin 2 [Source:HGNC Symbol;Acc:10555]
Mouse Orthologue:
Atxn2
Mouse Description:
ataxin 2 Gene [Source:MGI Symbol;Acc:MGI:1277223]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa870 Essential Splice Site Available for shipment Available now
sa16931 Essential Splice Site Available for shipment Available now
sa40527 Nonsense Mutation detected in F1 DNA Not yet available
sa33679 Nonsense Mutation detected in F1 DNA Not yet available
sa33678 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa870
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Essential Splice Site 95 1112 4 23
Genomic Location (Zv9):
Chromosome 5 (position 43324474)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41105739
GRCz11 5 41705892
KASP Assay ID:
554-0772.1 (used for ordering genotyping assays)
KASP Sequence:
TAAAAATGGCCTGATCTATGAAGGGGTTTTTAAAACATATGGCCCAGAGG[T/C]AAGGATACCACTTTGTATTGCTGATGTTAAGCATTTCTATCACTGTTAAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16931
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Essential Splice Site 146 1112 5 23
Genomic Location (Zv9):
Chromosome 5 (position 43324192)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41105457
GRCz11 5 41705610
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAGTRGTARTTCATTTCAAAGATGTGGAYCTCAACTATGCCAAGAAAGG[T/C]GAGAYCTTCTGTCAAATATTCTTGYTACTTTAATRGGYGTTTTACAGGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8199
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Essential Splice Site 470 1112 11 23
Genomic Location (Zv9):
Chromosome 5 (position 43298687)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41079952
GRCz11 5 41680105
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCGCAACAGCCCTTCTGGGGGAACCTGGTCATCTGTYGTCAGTGGTGG[T/C]AAGCTGGAAATATAAATCTGCTCTCAAAATTTTAGCTCATACTGACTCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2275
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Essential Splice Site 589 1112 14 23
Genomic Location (Zv9):
Chromosome 5 (position 43288976)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41070241
GRCz11 5 41670394
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACAGAAAACAAATAGATAATTTAAAGAAATTCAGTGCAGCTTTTAGGG[T/A]AAGTTTTCAGTCTCATCAGCAATGTTTCATAAGAAGCTTCCATTCTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40527
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Nonsense 590 1112 15 23
Genomic Location (Zv9):
Chromosome 5 (position 43288896)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41070161
GRCz11 5 41670314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAGAAGCTTCCATTCTTCCATTCACTAAAGCACTGCATTTTTTTGTAGT[T/A]GCAGCCTAGCTCAAGTTCAGATCCAGGTTTTGAAGCTATGGGGACCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33679
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Nonsense 751 1112 17 23
Genomic Location (Zv9):
Chromosome 5 (position 43286205)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41067470
GRCz11 5 41667623
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCCACTCTGACCCGACCCCAGGGTCAACCCAGCCCTTCCATCGTTGTA[C/T]AGCAGCCTCCTACGGTCTACGGCCAGACCATGTTCCAGATGTACCCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33678
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Essential Splice Site 923 1112 20 23
Genomic Location (Zv9):
Chromosome 5 (position 43271715)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41052980
GRCz11 5 41653133
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAAGAACTTCCCCAGCACAATGACTAAGCTCAACAAGCCCACATACAGT[G/A]TCACTGCTATGTATTGCTTTTCTTTTCGATAAATAACTCAACTCTACAGC
Associated Phenotype:
Not determined