Busch Lab

ZMP

azin1a

Ensembl ID:
ENSDARG00000052789
ZFIN ID:
ZDB-GENE-050417-20
Description:
ornithine decarboxylase antizyme inhibitor [Source:RefSeq peptide;Acc:NP_001017568]
Human Orthologue:
AZIN1
Human Description:
antizyme inhibitor 1 [Source:HGNC Symbol;Acc:16432]
Mouse Orthologue:
Azin1
Mouse Description:
antizyme inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1859169]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42831 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4686
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056101 Nonsense 61 198 4 7
ENSDART00000074706 Nonsense 63 454 4 12
ENSDART00000146607 Nonsense 63 73 4 4
ENSDART00000147236 Nonsense 63 449 4 12

The following transcripts of ENSDARG00000052789 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 56328475)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52839166
GRCz11 16 52724909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTGGGGGTGATCGTGCAGCAGCAGGCTCGCTGGAGAAATAAAATGGAC[C/T]AAATTCGGCCTTTCTACACCGTTAAGAGCAACAGCAGCCCTGTAGTTGTT
Long Flanking Sequence:
TAATAATTGATTTCTTTTATCTTTGCTATGATGACAGTACATACTATTTGACTAGTGTACAGCTTCAAGTGACATTTAAAGGTTAATTAGGGTGAAGTTAGGGTAATTAGGCAAGTCATTGTATAACAGTGGTTTGTTCTGTAGACAATCCAAAACAAATATTGCTTAAGGGGGCTAATAAAAGTGCTTTAAAACAATTAAAATCTCCTTTTTTTCTAGCCGAAATAAACAAGTAAGACTTTTTTTCAGAAGAAAAAATATTATAGGAAATACTGTGAAAAATTCCTAAATCTGTTCAACATCATTTGGGAAATATTTTTAAAACAACATAATTCACAGGAGGGCATAATAATTGTGGCTTTAACTGTATATCATCATATTGCACAGCTCAGTACTGAAGTATTGTCTTTGTTGGTTTTTAGGCACAGAAAAGTGCGTTTTTTGCTGCTGATCTGGGGGTGATCGTGCAGCAGCAGGCTCGCTGGAGAAATAAAATGGAC[C/T]AAATTCGGCCTTTCTACACCGTTAAGAGCAACAGCAGCCCTGTAGTTGTTGAACTGCTGGCTTCTCTCGGAACTGGCTTCATTTGTTCAAACAAGGTGAATATAAAACAAAATGTCTCATTGAAGCGAGACAGAAATTAATCCCATTATCTATTTGTGTCCCTTTGAAACCTATTTTTAAAATGTCTATTCTTGCATTCATCTGTTTGGTCTTGTGTGCTCGTCTTTCAGCATGAGCTGGACTTGGTTAAGGGCTTTGGCGTCTCATCTCAGGACATTATTCTGGGCGGCACGTGCAAACAGCTCTCCCATATCAAATATGCAGCCAAACACAACATCCCGCTCCTGGTTTGTGACAATGAGGCAGAGATGAGGAAGATCGCACGATGTCATCCTAAAGCAAAGTGAGTTATGCAGTCATACTGTACTGATTAGCGTCATAAAATAAACTATTTTGCAAGAAAGTTTAACATTTTAATTTAAAATATTAAAACTCATTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28752
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056101 None None 198 None 7
ENSDART00000074706 Nonsense 266 454 9 12
ENSDART00000146607 None None 73 None 4
ENSDART00000147236 Nonsense 266 449 9 12

The following transcripts of ENSDARG00000052789 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 56319573)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52830264
GRCz11 16 52716007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGTTAACCAGATGCTGAAGCCCATGCTGGACATGTATTTTCCTCGGT[C/A]GACTGGCTTGTCAATCATTGCTGAACCTGGAGCTTATTACGTTTCTTCTG
Long Flanking Sequence:
GTTTGGTGGTGATTGACAGGGTGCGTGCGCGATGTGTCTGAGGAGATATGCGGTGGGGAGGGGTGAGAAGGGTGCGCGACGATGCCTATTTGAGGACCGGGAGGAAGACGCGAGATCATCACTCGTTTGCGGGCATCCGGAGACTCGTGAAACTTCCCGCCCTGCTCATAATTCTCTCTTCATATAGCCGTAAGCCTATTACATATCCATAAAACACAGTGATATAACCGCGCTCGGATCAGATCGCTTTCTCACTGCAATCGATCCGCTCCAGATGTCGTTTCAATCGAACCTGACAAACCTAATGTTTTTTTATATGTCTTCAAATGGTACTGTTTTATAATTTAGAAGAGTCAAAAACTTACATACAGCAGCTTTTTATTTAAATATTTAATTGTTTTGCCATTTGTAAATACTTTGCCCCCTAAAGTGTTTTTTTTTTTTTTTTCCTCAGGTTAACCAGATGCTGAAGCCCATGCTGGACATGTATTTTCCTCGGT[C/A]GACTGGCTTGTCAATCATTGCTGAACCTGGAGCTTATTACGTTTCTTCTGCCTTCACGCTGGCCGTGAATATAATCGATAAGAAGACGGTGGCTCGGGACTGCAGTGCACAGCCACACGGTCAGTACTAGCTCAAATCAAGAATATGAGATACATTGTGGAGTTTTTTTTCTGTGGGGAATATAGAGGAGTAGTGTTGTCACGATACTGGAATTCGGTACCATTTGATACTGAAATTTTAAAAACTTCCATTTCCCGCTAACATTTGAGCGCTACTGAGCGCATTCTTAAACCAGGGTTTCCGCAGGGTCTTAAAGTCTTAAAATTTCAAAACCTAAATTTTAGGCCTTAAAAAGTCTTAAATTCACTGACAAATTGTATTGTACATCTTAAATAGTTTTAAACAGGTCTTAATTTTGCTTTGCCCAAGTAAAGCTACTCATTTTGGGCCGATATCCATCTAGTGATCAATAACACTCAATAAAACCTTATTTATTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42831
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056101 None None 198 None 7
ENSDART00000074706 Nonsense 303 454 9 12
ENSDART00000146607 None None 73 None 4
ENSDART00000147236 Splice Site None 449 None 12

The following transcripts of ENSDARG00000052789 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 56319463)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52830154
GRCz11 16 52715897
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCCGTGAATATAATCGATAAGAAGACGGTGGCTCGGGACTGCAGTGCA[C/T]AGCCACACGGTCAGTACTAGCTCAAATCAAGAATATGAGATACATTGTGG
Long Flanking Sequence:
CGAGATCATCACTCGTTTGCGGGCATCCGGAGACTCGTGAAACTTCCCGCCCTGCTCATAATTCTCTCTTCATATAGCCGTAAGCCTATTACATATCCATAAAACACAGTGATATAACCGCGCTCGGATCAGATCGCTTTCTCACTGCAATCGATCCGCTCCAGATGTCGTTTCAATCGAACCTGACAAACCTAATGTTTTTTTATATGTCTTCAAATGGTACTGTTTTATAATTTAGAAGAGTCAAAAACTTACATACAGCAGCTTTTTATTTAAATATTTAATTGTTTTGCCATTTGTAAATACTTTGCCCCCTAAAGTGTTTTTTTTTTTTTTTTCCTCAGGTTAACCAGATGCTGAAGCCCATGCTGGACATGTATTTTCCTCGGTCGACTGGCTTGTCAATCATTGCTGAACCTGGAGCTTATTACGTTTCTTCTGCCTTCACGCTGGCCGTGAATATAATCGATAAGAAGACGGTGGCTCGGGACTGCAGTGCA[C/T]AGCCACACGGTCAGTACTAGCTCAAATCAAGAATATGAGATACATTGTGGAGTTTTTTTTCTGTGGGGAATATAGAGGAGTAGTGTTGTCACGATACTGGAATTCGGTACCATTTGATACTGAAATTTTAAAAACTTCCATTTCCCGCTAACATTTGAGCGCTACTGAGCGCATTCTTAAACCAGGGTTTCCGCAGGGTCTTAAAGTCTTAAAATTTCAAAACCTAAATTTTAGGCCTTAAAAAGTCTTAAATTCACTGACAAATTGTATTGTACATCTTAAATAGTTTTAAACAGGTCTTAATTTTGCTTTGCCCAAGTAAAGCTACTCATTTTGGGCCGATATCCATCTAGTGATCAATAACACTCAATAAAACCTTATTTATTAGATTTAAGTTTTTTATTGCATATAGATAGTACACTACAGCTGTTAGACATTTTCACTGCAAATTCCCTAAATTAAATTCCCTAAACGGGGAAAAACTATCAACTAAATAATAC
Associated Phenotype:
Not determined