Busch Lab

ZMP

zgc:158863

Ensembl ID:
ENSDARG00000052747
ZFIN ID:
ZDB-GENE-070112-902
Description:
G patch domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001074099]
Human Orthologue:
GPATCH3
Human Description:
G patch domain containing 3 [Source:HGNC Symbol;Acc:25720]
Mouse Orthologue:
Gpatch3
Mouse Description:
G patch domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2442492]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32113 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32113
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083534 Nonsense 382 669 3 8
Genomic Location (Zv9):
Chromosome 16 (position 57123187)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53705752
GRCz11 16 53592579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGACACGCCCCCAACATCATGCATAATACAGGACACGCCCACAGCAT[C/A]ACAAAGAAAAGACACGCCCCCAACATCATGCATAATACAGGACACGCCCA
Long Flanking Sequence:
ACACGCCCAAAGGGACACGCCTACAACATCACACAGAAAACAGGGCAAGCCCACAACCTTATACAGAACGCAGGAAACGCCCACAGCATCACAAGCAAAACAAGACACGCCCACAATATCACTAACAATACAGGACACGCCCACAACAACACAAACAAATCAGGACACGCCTTCTACCTCATGCAAAATACAGGACACGCCCACAGCATCACAAAGAAAACAGGACACGCCCACAACCTCACAAAAACTGGACATGTCTACTACCTCATGCAAAATACAGGACACGCCCACAGCATCACAAAGAAAACAAGACACGCCCACAACATCATGCATAATACAGGACACGCCCACAACCTCACAAACCGTACAGGACACGCCCACAACCTCACAAAAACAGGACATGTCTACTACCTCATGCAAAATACAGGACACGCCCACAGCATCACAAAGAAAAGACACGCCCCCAACATCATGCATAATACAGGACACGCCCACAGCAT[C/A]ACAAAGAAAAGACACGCCCCCAACATCATGCATAATACAGGACACGCCCACAACCTCACAAACAAAACGATTAAACACACCCACAGCCTCACGCAAAATACAGGACACGCCCACATACACACAAACACTATATGAAGACACGCCCTCTCCACCTGTCAATCAACCGTCTCAGGAAGAAGAAAGTGAAGAGGAGCTGTCGGGCCCTGATGATGTGAGTTAAAGCTGCATCTTATTACAATTTTAAATAATATTGCTTAAAATTAATATGGCAAGAGTGATTATGGCTCAGTCAAATAACACATATAAGCCACTTCTGACACCAAATGATCACGAATAATAAGAAGTCAAGTTATTATTTGCTGTTCCTGAGTATATTAGTATGGTGTAGGGTCTCTTTTTGCAGCAAATTCACTGAGTGTGTTTGTGTGTTTCAGGATGACGACCGCTGTGAGGAGTGGGAGCGTCACGAAGCTCTTCACGAGGACATCACGGCTCAGGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3978
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083534 Nonsense 402 669 3 8
Genomic Location (Zv9):
Chromosome 16 (position 57123246)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53705811
GRCz11 16 53592638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGACAYGCCCCCAACATCATGCATAATACAGGACACGCCCACAACCTCA[C/T]AAACAAAACGATTAAACACACCCACAGCCTCACGCAAAATACAGGACACG
Long Flanking Sequence:
TATACAGAACGCAGGAAACGCCCACAGCATCACAAGCAAAACAAGACACGCCCACAATATCACTAACAATACAGGACACGCCCACAACAACACAAACAAATCAGGACACGCCTTCTACCTCATGCAAAATACAGGACACGCCCACAGCATCACAAAGAAAACAGGACACGCCCACAACCTCACAAAAACTGGACATGTCTACTACCTCATGCAAAATACAGGACACGCCCACAGCATCACAAAGAAAACAAGACACGCCCACAACATCATGCATAATACAGGACACGCCCACAACCTCACAAACCGTACAGGACACGCCCACAACCTCACAAAAACAGGACATGTCTACTACCTCATGCAAAATACAGGACACGCCCACAGCATCACAAAGAAAAGACACGCCCCCAACATCATGCATAATACAGGACACGCCCACAGCATCACAAAGAAAAGACACGCCCCCAACATCATGCATAATACAGGACACGCCCACAACCTCA[C/T]AAACAAAACGATTAAACACACCCACAGCCTCACGCAAAATACAGGACACGCCCACATACACACAAACACTATATGAAGACACGCCCTCTCCACCTGTCAATCAACCGTCTCAGGAAGAAGAAAGTGAAGAGGAGCTGTCGGGCCCTGATGATGTGAGTTAAAGCTGCATCTTATTACAATTTTAAATAATATTGCTTAAAATTAATATGGCAAGAGTGATTATGGCTCAGTCAAATAACACATATAAGCCACTTCTGACACCAAATGATCACGAATAATAAGAAGTCAAGTTATTATTTGCTGTTCCTGAGTATATTAGTATGGTGTAGGGTCTCTTTTTGCAGCAAATTCACTGAGTGTGTTTGTGTGTTTCAGGATGACGACCGCTGTGAGGAGTGGGAGCGTCACGAAGCTCTTCACGAGGACATCACGGCTCAGGAGAGAAGCAAAGAGCGTCTGTTTGAGGAGGAGATCGAGCTCAAGTGGGAGAAAGGAGGATC
Associated Phenotype:
Not determined