Busch Lab

ZMP

grina

Ensembl ID:
ENSDARG00000052746
ZFIN IDs:
ZDB-GENE-040426-1367, ZDB-GENE-040426-1367
Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) [Sour
Human Orthologue:
GRINA
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) [Sourc
Mouse Orthologue:
Grina
Mouse Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) Gene [

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa28759 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36273 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa28759
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074653 Essential Splice Site 93 337 2 7
ENSDART00000074655 Essential Splice Site 93 328 2 9
ENSDART00000074653 Essential Splice Site 93 337 2 7
ENSDART00000074655 Essential Splice Site 93 328 2 9
Genomic Location (Zv9):
Chromosome 16 (position 57026270)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53608835
GRCz11 16 53495662
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGCCGCTCCATACAGCACAGATCCATACTCACAGCCGTTTCCCAACGG[T/C]AAGAGTACTGCTTCACACAGGTGGGCCTGACAAACCACCTGTAGACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36273
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074653 Essential Splice Site 93 337 2 7
ENSDART00000074655 Essential Splice Site 93 328 2 9
ENSDART00000074653 Essential Splice Site 93 337 2 7
ENSDART00000074655 Essential Splice Site 93 328 2 9
Genomic Location (Zv9):
Chromosome 16 (position 57026270)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53608835
GRCz11 16 53495662
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGCCGCTCCATACAGCACAGATCCATACTCACAGCCGTTTCCCAACGG[T/C]AAGAGTACTGCTTCACACAGGTGGGCCTGACAAACCACCTGTAGACACAC
Associated Phenotype:
Not determined