Busch Lab

ZMP

CARD11

Ensembl ID:
ENSDARG00000052741
Description:
caspase recruitment domain family, member 11 [Source:HGNC Symbol;Acc:16393]
Human Orthologue:
CARD11
Human Description:
caspase recruitment domain family, member 11 [Source:HGNC Symbol;Acc:16393]
Mouse Orthologue:
Card11
Mouse Description:
caspase recruitment domain family, member 11 Gene [Source:MGI Symbol;Acc:MGI:1916978]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa45152 Nonsense Mutation detected in F1 DNA Not yet available
sa20104 Splice Site, Nonsense Available for shipment Available now
sa6912 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45153 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11885 Nonsense Available for shipment Available now
sa9530 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26134
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Nonsense 97 1122 2 23
Genomic Location (Zv9):
Chromosome 3 (position 41587641)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41451001
GRCz11 3 41592859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTATGTGGTTTTTCTGGAGAGTCTTGAGTTGTATTACCCTGACCTCTA[C/A]AAACTGGTCACGGGGAAGGAGCCGACACGCAGATGCTCCACTATAGTCGG
Long Flanking Sequence:
AAGACTTTTTTATTAAATTAAGTAAATATATGTGAAAATAAATAATTACATACATAAATAAATACATACATACATTATAATGATTAGAAAATGCAGTATTGTTGCAGTAGTATAGAAATCTATTATTTTCCAAGAATGGGGGATTATAATCATATTTGGAAACAATCATATTGGGGAACATTGCAAACAAAACACCCTAATTTTATTGATTTGATGTTAATTTTACTTTTAACTTGATTGGCATTTATTTTTTTAGCTGACGTGACATGAAAAAAACCTACAGTACATATTTAATTAAATTAAAAGCGACTTCAATTTTGTCGAACATGTACTATATAAAGTAACTTAATAAAGACGACATTAAGACATTACTCTGTATACTTTTTTAGTTTTGCTTGTGGTTTTGTTTCAGGCCGGCTGCTGGATATCCTGCACACGAAGGGAGAGCGAGGCTATGTGGTTTTTCTGGAGAGTCTTGAGTTGTATTACCCTGACCTCTA[C/A]AAACTGGTCACGGGGAAGGAGCCGACACGCAGATGCTCCACTATAGTCGGTGAGACACTTTTAAATTAAAATACTGCACATATAAATGATCTATGACCATGTCTTAAAATTGTTTGTTGCCTTGCACCTGCTTCTCCTGTGGGATGAGTATCTGCAATAAATCCCATTTCCAAATCCCATTTTGAGCAGTTGCTTCTAATAATAAATAATACATATAATAAATAAATAAATAATAATATGTAAGCACCTTGGTGGTACACTAATAGTATCAGAAGGTGCTATATAATTACCATACTCGTACAATATAACATATAATTGACATATCAAGTATACTACAGTGCATCCGGAAAGTATTCATATCACTTCACTTTTTCCACAATCTTTTATGCTACAGCCTTATTCCAAAATGTATTTAATTCATTTATTTCCTCAAAATTCTACAGACTATAGCCCATAATGAAAGTGTGAAAAAAAGATTTTTTGAAATTGTTGCAAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45152
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Nonsense 149 1122 3 23
Genomic Location (Zv9):
Chromosome 3 (position 41591120)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41454480
GRCz11 3 41596338
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGCAGCAGTCCAAGGCAAAAGACATGCAGCGGATGGACGTCATGACT[A/T]AATGCCGCACACTAGAAGACGAGCATAAAAAGCTGCGTCTAACCAACCAG
Long Flanking Sequence:
CATTTCCATGCTTTATTACACGTGGCATGCAAATGGTCTGGTAAACAACGGCGGACTTACAGCAGATCTCGCTTCTTGACATGTGGCTGTTTGTCACAATAAGAGACAAGCTTTGTTTGAGCATGGTTCATTGCTCCATCATTTGTGGTGTCGTGTTTCTGCTGTGTATTTAAATATGGCAGTCCTTGTGTTGTCTTTCTCCTGGCTTGCTGCTCACACAAGGGATGATTCTCTGTAAACCAGCATTCTGCAATGAATCTAGCTCCACCCTTTTGGCACTGTTCTGTTGTGTTAGGTATCGGTCACAAATGCATACTGTACTGTACCAAACCATACCACTTTCAAACGAGCCATTATTTGTGTAGTTGCATTTAATTGCCTGTTTTTGTCCTGCAGTGGAAGAGGGCCAGGAAGGCCTCATCCAGTTTTTAATGAATGAAGTCATGAAGCTTCAGCAGCAGTCCAAGGCAAAAGACATGCAGCGGATGGACGTCATGACT[A/T]AATGCCGCACACTAGAAGACGAGCATAAAAAGCTGCGTCTAACCAACCAGGAGCTGCTGACTTTCCAAGAGCGCTACAACAAGATGAAAGAAGAGCGCAATAACTATAACGATGAACTTATGAAGGTGAAGGATGACAACTATCAGCTTGCCATGCGCTACGCTCAGCTCAGCGAAGAGAAGAACATGGCCGTGATGAGGAGTCGAGACCTTCAGCTGGAGGTCAGAGAGATTCTGATTTGACTTGATTTTTTTTGCCTTCAAAATCTATACAAAAGATTTGACCACCGTCTCTCAATTTCCTCCAGATCGACCAGCTGAAGCACAAGCTGAACAAGGTGGAGGAGGAATGCAAAATGGAGAGGAGGCAGTCTCTGAAACTGAGGAACGACATTGAGAACCGACCCCGAAAAGAGCAGGTATTCGAGCTGGAGAGAGAGAATGAGGTCTTGAAGATCAAAGTTCAGGAGCTGCAGTCCATTATACAGGTGAAGACCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20104
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Splice Site, Nonsense 332 1122 6 23
Genomic Location (Zv9):
Chromosome 3 (position 41595747)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41459107
GRCz11 3 41600965
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCTGTGATGGGTTTAAATGAGCATCATTTAATCTAATAATGCACAGTA[C/A]CTGGAAGAGAAGGAGGACCTTGAGTTGAAGTGCTCCACTTTAGTGAAGGA
Long Flanking Sequence:
AATGCATTATTAAAAATCTATGTTTTGCCTTTTATCGTTAGTTAAAACATTGTGAGTTAACAAACTAAAATGACTAACTAAATAACTAATTAAATCATATTGTAAAGTGTTACTGAGTTAAAAAAAAACACATTTATAACAATAATGGCACATTGAAATTATATAAATCTTATAACTTCCCATTTTTATTCATAGCATATGAATGATAACTCATTAGTAATCAGAATTCCACATTCAAAACAAAACAGCAGAATGAAAATGTATACAGTTGTTGAGCATTTTGCCTGTAAATGATGAAATTTCATGCAATCAGCAGAGTTTGAGTTGCATGAAAATGTTTAGTCTGGAGTAAATGTTTGAACTGGAATATAATAACAACAATCTCAATTCTGTTGTTCTGAAAATTTCCTCTCGAGGTCATGTGATGCAATGTTGAACAATGCCATTTATTTGCTGTGATGGGTTTAAATGAGCATCATTTAATCTAATAATGCACAGTA[C/A]CTGGAAGAGAAGGAGGACCTTGAGTTGAAGTGCTCCACTTTAGTGAAGGACTGCGAAATGTACAAGAACCGCATGAATACCATCATGGTGCAGCTGGAAGAGGTGGAACGTGAACGGGACCAGGTTGAGTACTAATGGGTTTCTAACGATGGCTTTAGATCAGCTCATTTCAGGCTGCTTAAAAGGGTTACTGATAGACATTTGTTTTCTCCATCCCACAGGCTTTCAAATCGAGAGATGATTCTCAACATCTCGTCTCTCAGTGTCTAATCGACAAAGACAAGTATCGCAAGCAAATACGAGAGCTGGAAGAAAAGAGCGATGAGCTTCAAATCGAAATCGTACGAAAAGAAGCCAAGATAGTCAACCTGGAGTGCAAATTGAGAAGGATGGCTAAGGAAAATGGGTTGGATCAGGTGAGAAATGATCTGTGTGATTTAAAAGTTGTTGCTTTTTGCTTAACTGAAAATAATTAACATGGCCTTTTTATGATGTTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6912
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Essential Splice Site 438 1122 7 23
Genomic Location (Zv9):
Chromosome 3 (position 41596165)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41459525
GRCz11 3 41601383
KASP Assay ID:
554-5457.1 (used for ordering genotyping assays)
KASP Sequence:
CCTGGAGTGCAAATTGAGAAGGATGGCTAAGGAAAATGGGTTGGATCAGG[T/C]GAGAAATGAWCTGTGTGATTTAAAAGTTGTTGCTTTTTGCTTAAYTGAAA
Long Flanking Sequence:
CATGTGATGCAATGTTGAACAATGCCATTTATTTGCTGTGATGGGTTTAAATGAGCATCATTTAATCTAATAATGCACAGTACCTGGAAGAGAAGGAGGACCTTGAGTTGAAGTGCTCCACTTTAGTGAAGGACTGCGAAATGTACAAGAACCGCATGAATACCATCATGGTGCAGCTGGAAGAGGTGGAACGTGAACGGGACCAGGTTGAGTACTAATGGGTTTCTAACGATGGCTTTAGATCAGCTCATTTCAGGCTGCTTAAAAGGGTTACTGATAGACATTTGTTTTCTCCATCCCACAGGCTTTCAAATCGAGAGATGATTCTCAACATCTCGTCTCTCAGTGTCTAATCGACAAAGACAAGTATCGCAAGCAAATACGAGAGCTGGAAGAAAAGAGCGATGAGCTTCAAATCGAAATCGTACGAAAAGAAGCCAAGATAGTCAACCTGGAGTGCAAATTGAGAAGGATGGCTAAGGAAAATGGGTTGGATCAGG[T/C]GAGAAATGATCTGTGTGATTTAAAAGTTGTTGCTTTTTGCTTAACTGAAAATAATTAACATGGCCTTTTTATGATGTTTGATAACATATCAGCTATTGGACAATCTTCAAATAGGATAAACCTTCTTTTACATTAGAACATGTCCTTTTTATAAGACAGTGACAATCACACTATTATTTATTTGCAGACATCTCTTGTTATAGAAATGGCATTAAGTGTAACATTAGTTTACCACATACCAAAAAAAACCTCTTGTAAGACATATTTAGAAGAAGAATCCTTTGACACATTTAAAAAAGGCTTTAAGAAGATCACACCACAGCCTTTCTCCCTCTCTTTCAAACACACACATACTTTTAAATATGTATACATATATTTGGGTTGACATTCACTTTTTTGATCACCAGCCACTGTTGCTGGTAGTTTTCCAACATTACTAGCCACTCGCCATTTTCACTAGCCACAGTTTTGTTTTTGGGAAAATATATTTTCTAAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45153
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Essential Splice Site 587 1122 12 23
Genomic Location (Zv9):
Chromosome 3 (position 41607232)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41470592
GRCz11 3 41612450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCCTTCAGACACTGCAGATACTGACAGTGGAGACAATGCCGATATGGG[T/A]ATGAACACACATAAATCATTTATTCCGCCCACTTGCTGTCTGAATCATAC
Long Flanking Sequence:
TCTGGTTATCTCTATGATCATGCATGGACGGATCATAAAGGTTTCTGTACAGTTGTACCTATCTCTTTAAAGTGTTTTATATTCAATATATATATTTATATTCATTGTCAATTATAAGAAAAAATATATAAGTTTTTATTCATTTATTTATTATTTATTATAAGAATTTTATATTGTAAACATGGGTGATAATTCTTAATTTTAATGGGTAGTTCAGTGTATCCAAATTACATGAAACGGGAACCTTGTCTAACAACATTTTGTTTAAACAAGTTCTGTTTGAACTAATGTTGCCATAACGACGACAATAATACAAACACCGAAAAGACTTCCTTGCATTTCCTCAACAATCCCATAGTTAGCATTGCTAGAAACTAAAGTGCAATGATAGTAATTTGTTGCTGGGAGTGAAGAGTAAAACTGACTGTGCTGTATCTTTCTTTCAGCTTTCTCCCTTCAGACACTGCAGATACTGACAGTGGAGACAATGCCGATATGGG[T/A]ATGAACACACATAAATCATTTATTCCGCCCACTTGCTGTCTGAATCATACACTTAAGTGACTCGTCTTTGTAAAAATGTCTCTTTTCTTTTCTGCAGATGACCATGAACCATCATCCATCAATTCATCTTCCTCTTCCCACCAGTCTGAGATAATGGATTCGTATGATCTGGAGCAAGTCAATAACATCTTCAGGAAATTCTCGTTGGAGAGGTTTTTTTTTTTGTTTTATTATTTTAGTTATAATCTTAGAGTACTTCTATAATGGGTCTTTGAGCACTTCACTTTTTGCTATTCTTAAGAGGGAAGAAATCTCAGTTTCTGTCATCTCAATTTATCCAGACTCCACAATATCACTCTTTTGATTTTTTCCTTCTTCTCTAGACCTTTTCGTCCTTCATTGACCTCAGGCCCTCCACGAAACTCATTGCGAACGGTTCAGAGCCTTTCTCTCTCTGGAGAAAACCTTTTGTCTGAAATCACTCTGATTGGTGGAAATGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3429
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Nonsense 817 1122 17 23
Genomic Location (Zv9):
Chromosome 3 (position 41610177)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41473537
GRCz11 3 41615395
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGAGAAGCTGTTAAGTGAACTTAGCTGTCACCTCCTCCCCAGAGCCCAG[C/T]AGCTCCTCTTGGTGAAGATTCAGAAGCTGATGTGTCGAGGAGGCCGAGAA
Long Flanking Sequence:
GCACATTATATATAGTTTGTCATGATAAGTATAGGTTGCTTTGCTTTGACCCTCCGCTTTCTCGTTTCCAGGCTACAGGCGGCTGGTGAAGGATATTGAAGACGGCACAGTGGTATCTGGAGACTCCTTCTACATACGTCTCAATCTGAACATCTCCAGCCAGTCTGATAACTGCTCGCTGAATGTCAGATGTGACGAGGTCCTCCATGTTCTGGACACCATGCATCAAGACAAATGCGAATGGCTGTGTGCCCGTGTCGACCCTTTCACAGACAAGGACCTGGACAAAGGCACCATACCGAGTTACTCAAGGTGAGGAAGAAATGAGTGACCATTATTGTGTCGGTTTTCAAACCAAGTGTGAACACTGGTCTATTGCCTGCTGCAGATTGCCTGTCAGTGTGTTGGTGAGCGTGTGGGTGTGCATTTTTTTTTTGTCTGTTGACTGTGACGAGAAGCTGTTAAGTGAACTTAGCTGTCACCTCCTCCCCAGAGCCCAG[C/T]AGCTCCTCTTGGTGAAGATTCAGAAGCTGATGTGTCGAGGAGGCCGAGAAGATGTCGACACTCTGAGAGTGATCCGGGTCAGTTTCTTATGGATTGTTGGGGAAATGCATCTTGTTTTGGGTTTCACATTCATAGATGAGGGTAAACTGATTCTGCACAAACTGAAAGGCAATTACAGGGACAGTAACTTATAGAGTTATACTGTTTGGTAACTTATAGAACCTAGAAAGTCTGTCATAATTTATTTATTTTGATGACTTTACTTCGTTGGCAGAAACTCACTGTTTTATTCTTTTTATTCATTAATGGCAAAATGACTTTAATTTATTCTGTTTGTTTTATGCATCTGCTGTATGGAAAACTAAGAGTGACCCTTCAAAAATAAATTGAAGAAGCAGTTTATCAGTTTAGTAATTAATACATACACTTTATACAAATAAATCATCTTTAAATGGACAATTCATGTTTTAAAATGTGAATTAATTAAACAATACAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11885
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Nonsense 829 1122 17 23
Genomic Location (Zv9):
Chromosome 3 (position 41610213)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41473573
GRCz11 3 41615431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCCAGAGCCCAGYAGCTCCTCTTGGTGAAGATTCAGAAGCTGATGTGT[C/T]GAGGAGGCCGAGAAGATGTCGACACTCTGAGAGTGATCCGGGTCAGTTYC
Long Flanking Sequence:
TGCTTTGCTTTGACCCTCCGCTTTCTCGTTTCCAGGCTACAGGCGGCTGGTGAAGGATATTGAAGACGGCACAGTGGTATCTGGAGACTCCTTCTACATACGTCTCAATCTGAACATCTCCAGCCAGTCTGATAACTGCTCGCTGAATGTCAGATGTGACGAGGTCCTCCATGTTCTGGACACCATGCATCAAGACAAATGCGAATGGCTGTGTGCCCGTGTCGACCCTTTCACAGACAAGGACCTGGACAAAGGCACCATACCGAGTTACTCAAGGTGAGGAAGAAATGAGTGACCATTATTGTGTCGGTTTTCAAACCAAGTGTGAACACTGGTCTATTGCCTGCTGCAGATTGCCTGTCAGTGTGTTGGTGAGCGTGTGGGTGTGCATTTTTTTTTTGTCTGTTGACTGTGACGAGAAGCTGTTAAGTGAACTTAGCTGTCACCTCCTCCCCAGAGCCCAGCAGCTCCTCTTGGTGAAGATTCAGAAGCTGATGTGT[C/T]GAGGAGGCCGAGAAGATGTCGACACTCTGAGAGTGATCCGGGTCAGTTTCTTATGGATTGTTGGGGAAATGCATCTTGTTTTGGGTTTCACATTCATAGATGAGGGTAAACTGATTCTGCACAAACTGAAAGGCAATTACAGGGACAGTAACTTATAGAGTTATACTGTTTGGTAACTTATAGAACCTAGAAAGTCTGTCATAATTTATTTATTTTGATGACTTTACTTCGTTGGCAGAAACTCACTGTTTTATTCTTTTTATTCATTAATGGCAAAATGACTTTAATTTATTCTGTTTGTTTTATGCATCTGCTGTATGGAAAACTAAGAGTGACCCTTCAAAAATAAATTGAAGAAGCAGTTTATCAGTTTAGTAATTAATACATACACTTTATACAAATAAATCATCTTTAAATGGACAATTCATGTTTTAAAATGTGAATTAATTAAACAATACAAAGTATTAGGATCTCTTTCACATGGTCAGTCTCTTTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9530
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Nonsense 994 1122 21 23
Genomic Location (Zv9):
Chromosome 3 (position 41619710)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41483070
GRCz11 3 41624928
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGACAAAAGATGAATTCCTCATGAAACAGAAGATAGAGCCCATCATTTA[T/A]TCCAAAGAAAAGCAGGCGGGCACGTATGAATGCATCACCCCAGAAAATAT
Long Flanking Sequence:
TAATTTGAACAAATTTAAAAAAAATATTTTCGAGTGTAACAAGAACATCATCAAATAAAGTTTACCAGTTTAAATTACTATACAGCTACTTATTTACAGCTTCATGGTCAAAGAAACAGCTTAAGTTTCAGAGTTTGCAAAGAGAAGTTTAAAACAAATTGCTTTAGATTTATATACAAAAGAAAAGCACATATCAGCAGATTCTTTCAATAAGTCTCAGAATGTGAGAATGAAATGCAAATACTAATTGTTTGTTAAGATCACAGCTTTTGTGTTTGACTAAACATCCCCAGCGGAGTTTTAATTGTAATGGATCTTCAACTAGTTATTACTTTAATAAAAAGATTCACAAATGCGATGTTGATTCACAGCCGCAATGCTTTAAATCCTCACAGTGTTTTCCCTAACATGCCTGTTTATAACTTCTAATTCATCTTCTTCGCAGACATTGTGACAAAAGATGAATTCCTCATGAAACAGAAGATAGAGCCCATCATTTA[T/A]TCCAAAGAAAAGCAGGCGGGCACGTATGAATGCATCACCCCAGAAAATATAGAAGCCGTTGCCTTCAAGGTACAGTAATAAATGCTCTTTTCAGAAGAATTTAATAATAGCTAAATTATGTTTTTGCTTTTCATGTGCTGTCATTTCTTCTGCTTACTCAAGAGGCTTGTCAGATATTTATGCGTTCGCTGTTTTGCCCAGCAATTTTATTTCAAAGTGCTTCCACTCAGTGAGAGCATTAACACTTTCCCAAAGACATCCGTGCGATTTTTCACACGGCATCTGTCCTAAACTCTTAGGCCCCGTTTACACTAGTGCGTATTAGTTTTAAAACGGCGTTTTAGAATGAAAACGATCCGCGTCCACACTCGCGTTTTACCCAGCGTTTCTGAACTGCTCTCCGTCCACACCAAAACGCTGAAAACGCACATCACGTGACCACACACACACACTTTGGCAATCGCTGGAGCCCATCTACCCAGATGAGAGCTCTGCTAGTC
Associated Phenotype:
Not determined