Busch Lab

ZMP

sltm

Ensembl ID:
ENSDARG00000052728
ZFIN ID:
ZDB-GENE-040426-2647
Description:
SAFB-like transcription modulator [Source:RefSeq peptide;Acc:NP_998498]
Human Orthologue:
SLTM
Human Description:
SAFB-like, transcription modulator [Source:HGNC Symbol;Acc:20709]
Mouse Orthologue:
Sltm
Mouse Description:
SAFB-like, transcription modulator Gene [Source:MGI Symbol;Acc:MGI:1913910]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9398 Nonsense Mutation detected in F1 DNA Not yet available
sa11923 Nonsense Available for shipment Available now
sa14688 Essential Splice Site Available for shipment Available now
sa9967 Nonsense Available for shipment Available now
sa10316 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9398
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024819 None None 458 None 11
ENSDART00000027396 Nonsense 194 448 5 10
ENSDART00000123464 Nonsense 219 992 6 20
ENSDART00000139546 Nonsense 25 269 1 5
ENSDART00000142818 Nonsense 191 983 5 20

The following transcripts of ENSDARG00000052728 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 31890026)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30282368
GRCz11 7 30553518
KASP Assay ID:
2259-8991.1 (used for ordering genotyping assays)
KASP Sequence:
CTCCTGAACCCCTGAAAGAAGTTGAGGATGACAATATATCTGTCACCATC[C/T]AGGCWGAAGATGCCATCACACTRGATGTGGATGGCGAYGACCTCCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11923
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024819 None None 458 None 11
ENSDART00000027396 Nonsense 228 448 5 10
ENSDART00000123464 Nonsense 253 992 6 20
ENSDART00000139546 Nonsense 59 269 1 5
ENSDART00000142818 Nonsense 225 983 5 20

The following transcripts of ENSDARG00000052728 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 31889924)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30282266
GRCz11 7 30553416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGTAAACATGTGAAAATTCCAGATTCTGAGGCAGACAAGTGCTGCGAA[G/T]AGCCTGAGGCCACTGCTGAGATGGGGCAGGAGACAGACTCTCTGACTRAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14688
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024819 Essential Splice Site None 458 2 11
ENSDART00000027396 None None 448 None 10
ENSDART00000123464 Essential Splice Site 548 992 12 20
ENSDART00000139546 None None 269 None 5
ENSDART00000142818 Essential Splice Site 520 983 11 20

The following transcripts of ENSDARG00000052728 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 31880760)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30273102
GRCz11 7 30544252
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTCAATAAATCTCGTCCTCCTTTYAGAAGGGGTGGGAGGTTTGAGAAG[G/A]TACAATARACTTACTTAGAAAGTAATTCATTTTCTTTAGAATGTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9967
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024819 Nonsense 140 458 6 11
ENSDART00000027396 None None 448 None 10
ENSDART00000123464 Nonsense 674 992 15 20
ENSDART00000139546 None None 269 None 5
ENSDART00000142818 Nonsense 665 983 15 20

The following transcripts of ENSDARG00000052728 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 31879983)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30272325
GRCz11 7 30543475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCGACGCAAGGAAGCAGAGCGTTTGGCTCGTGAACGYGAGGAACTAAGA[C/T]GACAACAGGAACAGCTGCGTTAYGAGCAGGAGAAACGAAACAACTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10316
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024819 Nonsense 270 458 8 11
ENSDART00000027396 None None 448 None 10
ENSDART00000123464 Nonsense 804 992 17 20
ENSDART00000139546 None None 269 None 5
ENSDART00000142818 Nonsense 795 983 17 20

The following transcripts of ENSDARG00000052728 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 31878961)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30271303
GRCz11 7 30542453
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAAACTGTACGGAGAGCAGAACMACCGCCTCCACCTCGTGCAGAGCTC[C/T]GAGACAGTGATCGACGAGARATTCGAGATCGTGATGAGCGCAGACAGGTG
Associated Phenotype:
Not determined