Busch Lab

ZMP

zgc:110727

Ensembl ID:
ENSDARG00000052721
ZFIN ID:
ZDB-GENE-050522-471
Description:
DNA primase large subunit [Source:RefSeq peptide;Acc:NP_999947]
Human Orthologue:
PRIM2
Human Description:
primase, DNA, polypeptide 2 (58kDa) [Source:HGNC Symbol;Acc:9370]
Mouse Orthologue:
Prim2
Mouse Description:
DNA primase, p58 subunit Gene [Source:MGI Symbol;Acc:MGI:97758]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa8833 Nonsense Mutation detected in F1 DNA Not yet available
sa8806 Nonsense Mutation detected in F1 DNA Not yet available
sa12346 Essential Splice Site Available for shipment Available now
sa42193 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15538 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8833
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Nonsense 149 508 5 14
ENSDART00000136406 Nonsense 149 508 4 13
ENSDART00000146216 Nonsense 158 199 4 5
ENSDART00000005004 Nonsense 149 508 5 14
ENSDART00000136406 Nonsense 149 508 4 13
ENSDART00000146216 Nonsense 158 199 4 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23832496)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23478156
GRCz11 13 23608606
KASP Assay ID:
2260-6370.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTCGTTAYMGRTTCGGGATTCTTTCTTCAAAGCACAAGACTGAGTTTT[T/A]GCATAAGAATAATTTGAAGTATGAGACGGTAAGGCTTTTAAAAATACCTT
Long Flanking Sequence:
CTAAGCGTTCTAAAGTATGAACAAATTAAAACAAAAGTAAACAAAAGTTGAAAACTTAAAACAAAAGTTGAAAGTTAAAAATGAAACACCCGATATTGCATGAAACTCTGGAGGAAAGGCTGGATAGCCTGGTAATGCGAGATTGATTGTTTTATACTGAAAATTGCCTTCATAAAGTGCTTTCTTGGTTTTATTCATATTTCTTTGCATGTTGAACCCACGACGGCCTCAACAGGAAAAAAAACTGCAATTGCGTTTATTGCGTTCATTTTTTTACGTGTTAAATATTTCAAATTAATCGCATGCGTTAATGCACTAATTTTGACAGCACTAATCAAAAAAAAAAAAGAGGCTAATAATTCTGACTTCAACTGCATTTAATAAATCGCATACTTTTTTTTGCTTTAGGGAGGACCTTAGGCGATGGTTTATCCAGCAGGAAATGGATCTTTTTCGTTACAGGTTCGGGATTCTTTCTTCAAAGCACAAGACTGAGTTTT[T/A]GCATAAGAATAATTTGAAGTATGAGACGGTAAGGCTTTTAAAAATACCTTTTGCAACCTTATCATTTATTTATTGTTAGTTATTGCAAAACTGTAAAAAAAAAAAAGGAACTGTTATAAATGTAACTTTTAATATATGTTATCATCAAAGTAACCATTTTCACAGTTTGAATTTAGATGTTTGTCTTTATACAGAGATGATTTATATTGATTATTTCCTTATAATCATTTTCAAAACTGATGTGATGCTTCAGCTTTTCAATGCATACCTGACCAATATGGTTTTACAGGTCTTAAAGGTTTTAAAAAATATCTACCACAATTTAAGACTTAAAAATATCTTGAGTCATAGCAAAACGTCTTTATTAAGTCATTGGATTAAACATTGATTTATTGAATGATTTTTGTGACTATACAAATATCTAATAATTTAAAATACTGTATATTATTATTCTATATTTACTTAAATCAAGCAAATTAATGCAAGAAGAAATTAATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8806
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Nonsense 149 508 5 14
ENSDART00000136406 Nonsense 149 508 4 13
ENSDART00000146216 Nonsense 158 199 4 5
ENSDART00000005004 Nonsense 149 508 5 14
ENSDART00000136406 Nonsense 149 508 4 13
ENSDART00000146216 Nonsense 158 199 4 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23832496)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23478156
GRCz11 13 23608606
KASP Assay ID:
2260-6370.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTCGTTAYMGRTTCGGGATTCTTTCTTCAAAGCACAAGACTGAGTTTT[T/A]GCATAAGAATAATTTGAAGTATGAGACGGTAAGGCTTTTAAAAATACCTT
Long Flanking Sequence:
CTAAGCGTTCTAAAGTATGAACAAATTAAAACAAAAGTAAACAAAAGTTGAAAACTTAAAACAAAAGTTGAAAGTTAAAAATGAAACACCCGATATTGCATGAAACTCTGGAGGAAAGGCTGGATAGCCTGGTAATGCGAGATTGATTGTTTTATACTGAAAATTGCCTTCATAAAGTGCTTTCTTGGTTTTATTCATATTTCTTTGCATGTTGAACCCACGACGGCCTCAACAGGAAAAAAAACTGCAATTGCGTTTATTGCGTTCATTTTTTTACGTGTTAAATATTTCAAATTAATCGCATGCGTTAATGCACTAATTTTGACAGCACTAATCAAAAAAAAAAAAGAGGCTAATAATTCTGACTTCAACTGCATTTAATAAATCGCATACTTTTTTTTGCTTTAGGGAGGACCTTAGGCGATGGTTTATCCAGCAGGAAATGGATCTTTTTCGTTACAGGTTCGGGATTCTTTCTTCAAAGCACAAGACTGAGTTTT[T/A]GCATAAGAATAATTTGAAGTATGAGACGGTAAGGCTTTTAAAAATACCTTTTGCAACCTTATCATTTATTTATTGTTAGTTATTGCAAAACTGTAAAAAAAAAAAAGGAACTGTTATAAATGTAACTTTTAATATATGTTATCATCAAAGTAACCATTTTCACAGTTTGAATTTAGATGTTTGTCTTTATACAGAGATGATTTATATTGATTATTTCCTTATAATCATTTTCAAAACTGATGTGATGCTTCAGCTTTTCAATGCATACCTGACCAATATGGTTTTACAGGTCTTAAAGGTTTTAAAAAATATCTACCACAATTTAAGACTTAAAAATATCTTGAGTCATAGCAAAACGTCTTTATTAAGTCATTGGATTAAACATTGATTTATTGAATGATTTTTGTGACTATACAAATATCTAATAATTTAAAATACTGTATATTATTATTCTATATTTACTTAAATCAAGCAAATTAATGCAAGAAGAAATTAATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12346
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Essential Splice Site 345 508 10 14
ENSDART00000136406 Essential Splice Site 345 508 9 13
ENSDART00000146216 None None 199 None 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23765625)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23411285
GRCz11 13 23541735
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGTTCTGGAGGTCAGAGTTTGTCAAGGGGAAAGTYGATGCAGACAAG[G/T]TAACTCTTCAACTTCAGCTTCTAACTCCCTCACATWGTCCTGGTTTTCCC
Long Flanking Sequence:
CTGTATAACTGTCCATTCAAACCAAGGGTTTAGCGTTTGCATATATAAGAACATGCACATTCTGCTCTGGCCTTGCACATTTCACATCTAAAAAGTTATCCGTTTCATTTGAATTTTACATTTAAATTTAGTCTTTTAAAGCAGCGGAATGGTCAGACAGACTCAGCATTGCTTAATAGACTTTAGCTGTCATGAGCTCAGTGACTGTGTCTTCATGTTTCAGTTGAAGTTTAGTCAACACATTCAGCAAAGCTGCTCATTCCATTGCACTTCAGGGGATCTTTAATAACCTCTCTATTGTTTATTTCCACCAGCTCTCAGGCAAGTCGTTTCCTCTATGTATGAGGCATCTCCACAAGGCACTGAGGGAGAACCACCACCTGCGGCACGGTGGACGCATGCAGTACGGCCTCTTCCTCAAGGGCATTGGTCTTACTCTGGAACAGGCCATGCAGTTCTGGAGGTCAGAGTTTGTCAAGGGGAAAGTTGATGCAGACAAG[G/T]TAACTCTTCAACTTCAGCTTCTAACTCCCTCACATTGTCCTGGTTTTCCCCAAACATACATCCCAAGATGCTTACTTCATATTTTTGTGTTATTAGCAATTCTTTTAATTCTGCTGATGTGATTTTTTTTTCTTCACCCCTCAATAACTCTTGAGAGGGTCACCCACATGAGCAAGAGAATGTATTAGAAGGCCACGTTTAGTTCTAATGCTTGTGATAATTTGCCGCCCTTCCATCTTGTCCTTAATTACAATTCCAGAGGAACACGTGAGATCTTCGTTTTCGCGCATGGTACATTAAACAAGAAAATTACACCCCCAGTCTTAGACCTATGTTTCCCTCCTCCCTGCACTCTGCAAATGATTGCTTATTCTCAAAAGATGCTCAATCAAGGAGAAACAAATGAATTTTATATCCTTACCTGAGAATGACCATTTTGTCAGACAGGCTTATGTAGTGATCTTTAGCCCCACAAGAGCACAGTAGCATCTCAGAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42193
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Essential Splice Site 345 508 10 14
ENSDART00000136406 Essential Splice Site 345 508 9 13
ENSDART00000146216 None None 199 None 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23765624)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23411284
GRCz11 13 23541734
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGTTCTGGAGGTCAGAGTTTGTCAAGGGGAAAGTTGATGCAGACAAGG[T/C]AACTCTTCAACTTCAGCTTCTAACTCCCTCACATTGTCCTGGTTTTCCCC
Long Flanking Sequence:
TGTATAACTGTCCATTCAAACCAAGGGTTTAGCGTTTGCATATATAAGAACATGCACATTCTGCTCTGGCCTTGCACATTTCACATCTAAAAAGTTATCCGTTTCATTTGAATTTTACATTTAAATTTAGTCTTTTAAAGCAGCGGAATGGTCAGACAGACTCAGCATTGCTTAATAGACTTTAGCTGTCATGAGCTCAGTGACTGTGTCTTCATGTTTCAGTTGAAGTTTAGTCAACACATTCAGCAAAGCTGCTCATTCCATTGCACTTCAGGGGATCTTTAATAACCTCTCTATTGTTTATTTCCACCAGCTCTCAGGCAAGTCGTTTCCTCTATGTATGAGGCATCTCCACAAGGCACTGAGGGAGAACCACCACCTGCGGCACGGTGGACGCATGCAGTACGGCCTCTTCCTCAAGGGCATTGGTCTTACTCTGGAACAGGCCATGCAGTTCTGGAGGTCAGAGTTTGTCAAGGGGAAAGTTGATGCAGACAAGG[T/C]AACTCTTCAACTTCAGCTTCTAACTCCCTCACATTGTCCTGGTTTTCCCCAAACATACATCCCAAGATGCTTACTTCATATTTTTGTGTTATTAGCAATTCTTTTAATTCTGCTGATGTGATTTTTTTTTCTTCACCCCTCAATAACTCTTGAGAGGGTCACCCACATGAGCAAGAGAATGTATTAGAAGGCCACGTTTAGTTCTAATGCTTGTGATAATTTGCCGCCCTTCCATCTTGTCCTTAATTACAATTCCAGAGGAACACGTGAGATCTTCGTTTTCGCGCATGGTACATTAAACAAGAAAATTACACCCCCAGTCTTAGACCTATGTTTCCCTCCTCCCTGCACTCTGCAAATGATTGCTTATTCTCAAAAGATGCTCAATCAAGGAGAAACAAATGAATTTTATATCCTTACCTGAGAATGACCATTTTGTCAGACAGGCTTATGTAGTGATCTTTAGCCCCACAAGAGCACAGTAGCATCTCAGAAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15538
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Nonsense 370 508 11 14
ENSDART00000136406 Nonsense 370 508 10 13
ENSDART00000146216 None None 199 None 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23737395)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23383055
GRCz11 13 23513505
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCCGCCACATGTTTGGGAAGGAAGGCAAGCGCWCTGACTACACCCCCTA[C/A]AGTTGCATGAAGGTGATTTTGTMAAACCCACCCAGCCAAGGCGACTACCA
Long Flanking Sequence:
AAATGTGCATTTCACATATTTGCATACAGTTTGAGTGTTCAGACTGTTTTTATTTTCCTTGGGGTTGCAGCTCTCATGTGTTAATTTTTTTTAATTTGGTTTGATGCTGATGCCTCAGAGACATGAGATTTGTGTGTGGAGAGTGAAACCGAGACGGGGGAGGGGAGAGAGACAGAGAGCAGCCACATTATCCATAATCCAGTCACAGCTGTCTGCGGTTTGGCGACACCGCTACAGCAGGTCCCTGCTAATAGCTCTATATTTCATAGCGGAAAACGCCCTGCCACAACCCACTTGATGTACGACAATGTCTTCGTTTCACCCACAACCTCCCCACCATTCCTACCCCTGTTCTTGCACGCTTTACTGTCCTCTTTCTTAAACTCACCATCACTTTCTCTCTCTCTTCTTTGTCTTGCTCTGCAGTTTGATAAAGCATATGCCTACAGCATCCGCCACATGTTTGGGAAGGAAGGCAAGCGCACTGACTACACCCCCTA[C/A]AGTTGCATGAAGGTGATTTTGTCAAACCCACCCAGCCAAGGCGACTACCATGGTGAGTCATACTGAGTCAGACTGTTGGTTTTCAATGCGATCCGTTCCCCCGAGGCCCATATTTAGTTCTGTAGCGAAGAGAATTAAAAGAGTGCTTAGTACGCAGGTGGTCTTAAATTAGTTCTAAAAAAATTCCCAAGTCCAGGCTGGCTAATTGATAACACCTGCTTTTCGCCATGCATGTAATGGGCAAAATCCATTTGAAAAGAGCATCATTAAAGGTAAGAGAGAGTAAGTGTGTCAAAGATTGAAGAACATTGCTGTCTTATGTGTAGATTTGCTATACTGTTGCAAGGCTTTACAGCACTTCTACTTTAATGTATGTTTTAATAATAGACAAAAATGTCATGCTTTAGGAACACTTATTTCACTTCAAAGGTGCGGTATGTAAGTTTTTGACTTTTCTAAAGCATAAAAATTCCATAATGTGTTTGCAGATATTTAAGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3839
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Nonsense 474 508 14 14
ENSDART00000136406 Nonsense 474 508 13 13
ENSDART00000146216 None None 199 None 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23712443)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23358103
GRCz11 13 23488553
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAGCTTCTGGGTGGAGGCCAAGGCATCAAGAAAGAAGTGGAGATGTCA[C/T]AAAAAAGCCAAGAAAATCCTCCCRGTGCGTCCCGTCCATCTCAGGCAAAC
Long Flanking Sequence:
CTTTAAAATGCCGTAACTGTATCAGTATTCAGTATTAGTGTGATTATATTATTAATGACCTCCAGAACTGTCAAGAGCGTCTGTGCCCCACATCTCACACCTTCAAATGATACCACATGTTCATTGCATGTCAGCATTGTCTAGTGAGGAGCAAGTCATTTATTAAATAATGTAAAGATTCATGCAGCTTTTGCTTTTACTGTTTGCTTTTAATTTTACTGTTGATATTTGGCACCAGTTAATCAGGAAGTGACTATTTTGTTCTCTTTGGATGGAAATGCTGCTTTATTCGCTGGTCTTTATGCAATATTCTAGTTTTGCACATAAATTTTATTTGCATTTTTGGATGAAGCTTCTGTCTTCTGCTTACATTTTGTCTTGTTTGTTTGTTACAGGTTGAGGATGCTGGGTTTTCTCTCAATCATCCAAACCAGTACTTCACAGAGAGCCAGAAGCTTCTGGGTGGAGGCCAAGGCATCAAGAAAGAAGTGGAGATGTCA[C/T]AAAAAAGCCAAGAAAATCCTCCCGGTGCGTCCCGTCCATCTCAGGCAAACCCTAAACAGGCCCAAGAGGAGATGGGGGATTTAGACTCCTTCTTCCAGGATGAATGATTTTGTAGAACCTAAGGAAAATACAGGGCTCTTACTTGTATTCACTGTTTAAGACACAATTGTCTTTTCACCATTAAAAAACTTTCATATCTGTTTTTTTACCTTGTCTTTATATTGATAAGATTCTTCTCAAATTACATGTTTTTACCAAAAAAAAAAAAAAAGAATAAATAAAAGCACATTAAAATTACATAACGTTTCTTAAGTTTTGTTTATTTATTTTTTGTTACAAAGTACTGAAATCTAAAAAACCAGGACACACCAAGTTAAAGATCACCCATTGGACCTTTCGAAAAATATAAAACAGTATACTGTAATTCATCAAGAATCCATTAAATTGATCATAACAACTGTAAATACATAGTTTCACAGAAATGATTGGAGGTAAAATGA
Associated Phenotype:
Not determined