Busch Lab

ZMP

bdh2

Ensembl ID:
ENSDARG00000052696
ZFIN ID:
ZDB-GENE-050417-343
Description:
3-hydroxybutyrate dehydrogenase type 2 [Source:UniProtKB/Swiss-Prot;Acc:Q561X9]
Human Orthologue:
BDH2
Human Description:
3-hydroxybutyrate dehydrogenase, type 2 [Source:HGNC Symbol;Acc:32389]
Mouse Orthologue:
Bdh2
Mouse Description:
3-hydroxybutyrate dehydrogenase, type 2 Gene [Source:MGI Symbol;Acc:MGI:1917022]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39664 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available
sa32733 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45080 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39663 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39664
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074597 Splice Site None 245 None 10
ENSDART00000132542 Essential Splice Site None 245 1 10
ENSDART00000133715 None None 177 None 7

The following transcripts of ENSDARG00000052696 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 44110038)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43026354
GRCz11 1 43727518
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGACGTTTGTTCATCACGTGTGTTGTTTTCACTAGTTGTCACTTGTCAG[T/A]AAGTTCTTCTACTGTTTATTGTGTTTTTTCTTCTTGTAAACCGATGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32733
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074597 Essential Splice Site 177 245 7 10
ENSDART00000132542 Essential Splice Site 177 245 7 10
ENSDART00000133715 None 177 177 7 7

The following transcripts of ENSDARG00000052696 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 44102605)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43018921
GRCz11 1 43720085
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGCTGATTTCCTGGAACAAGGCATCCGCTGTAATTGCATCTGCCCAG[G/A]TATGCTAATTCGTTTATCGATTGGTTTCCTCTGTGGACCTTAGATGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45080
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074597 Essential Splice Site 178 245 None 10
ENSDART00000132542 Essential Splice Site 178 245 None 10
ENSDART00000133715 None 178 177 None 7

The following transcripts of ENSDARG00000052696 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 44102604)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43018920
GRCz11 1 43720084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGCTGATTTCCTGGAACAAGGCATCCGCTGTAATTGCATCTGCCCAGG[T/C]ATGCTAATTCGTTTATCGATTGGTTTCCTCTGTGGACCTTAGATGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39663
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074597 Nonsense 211 245 9 10
ENSDART00000132542 Nonsense 211 245 9 10
ENSDART00000133715 None None 177 None 7

The following transcripts of ENSDARG00000052696 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 44099588)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43015904
GRCz11 1 43717068
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTTTCAGGCTTTTAAAGACTTTATGGCCAGACAGAGGACCGGTCGAT[T/A]GTGCACTGCAGAGGAAGTGGCGCATCTGTGTGTGTACTTGGCTTCAGATG
Associated Phenotype:
Not determined