Busch Lab

ZMP

csnk1a1

Ensembl ID:
ENSDARG00000052674
ZFIN IDs:
ZDB-GENE-020419-19, ZDB-GENE-020419-19
Description:
casein kinase I isoform alpha [Source:RefSeq peptide;Acc:NP_694483]
Human Orthologues:
CSNK1A1, CSNK1A1L
Human Descriptions:
casein kinase 1, alpha 1 [Source:HGNC Symbol;Acc:2451]
casein kinase 1, alpha 1-like [Source:HGNC Symbol;Acc:20289]
Mouse Orthologue:
Csnk1a1
Mouse Description:
casein kinase 1, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1934950]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28350
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121429 Nonsense 259 365 8 11
ENSDART00000130655 Nonsense 231 337 7 10
Genomic Location (Zv9):
Chromosome 14 (position 40269064)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38432298
GRCz11 14 38772612
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACAGAGTGCAACAATTTCATTTTTTGCCCCCAGGCTGCCACAAAGAAA[C/T]AGAAATATGAGAAGATTAGTGAGAAAAAGATGTCGACCCCTGTTGAGGTG
Associated Phenotype:
Not determined