Busch Lab

ZMP

si:ch73-22c10.1

Ensembl ID:
ENSDARG00000052652
ZFIN ID:
ZDB-GENE-030131-3264
Human Orthologue:
FERMT1
Human Description:
fermitin family member 1 [Source:HGNC Symbol;Acc:15889]
Mouse Orthologue:
Fermt1
Mouse Description:
fermitin family homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443583]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23801 Essential Splice Site Available for shipment Available now
sa11922 Nonsense Available for shipment Available now
sa37147 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23801
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074546 Essential Splice Site 409 666 9 14
ENSDART00000147637 None None 127 None 3
ENSDART00000147897 Essential Splice Site 404 661 10 15

The following transcripts of ENSDARG00000052652 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 45989820)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45883509
GRCz11 20 45787229
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACAAAGATTCTGCCAATAAAGAGCCCATTGAGCAGCTTCATCTACGAG[G/A]TGAGCAGCCAATCAGAGAGCATGTCATTCACTTCAGTGCATTTGCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11922
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074546 Nonsense 512 666 11 14
ENSDART00000147637 None None 127 None 3
ENSDART00000147897 Nonsense 507 661 12 15

The following transcripts of ENSDARG00000052652 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 45986241)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45879930
GRCz11 20 45783650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAWGTAGAGTCCATGGAGATGAACCCCGAGTGCTTTGTTTCTCCRCGATA[T/A]GCTAAGAAGTTYAAGACCAAACAGGTCAGATCACAATCTCAGGACCRGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37147
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074546 Nonsense 557 666 12 14
ENSDART00000147637 None None 127 None 3
ENSDART00000147897 Nonsense 552 661 13 15

The following transcripts of ENSDARG00000052652 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 45983809)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45877498
GRCz11 20 45781218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAAAATGCGTTTCATTCAAGCATGGCAGTCTCTGCCCGATTTTGGCATC[A/T]AGTACTATATTGTCAGGTAATTTTGCTGAATTGTTTAATTGCTATTGAAT
Associated Phenotype:
Not determined