Busch Lab

ZMP

TRIM65 (76 of 82)

Ensembl ID:
ENSDARG00000052646
Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3870
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056984 Nonsense 117 362 1 5
Genomic Location (Zv9):
Chromosome 13 (position 46767520)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46063288
GRCz11 13 46199912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTCTGTATAGGAAGAAAAAKCAAAGCCGTCAAGTCTTGTCTGGTGTGTT[T/A]GGCGTCATTCTGTCAAACTCACCTTCAGCCTCATTATCAATCTCAAGCTT
Associated Phenotype:
Not determined