Busch Lab

ZMP

ca10a

Ensembl ID:
ENSDARG00000052644
ZFIN IDs:
ZDB-GENE-050419-266, ZDB-GENE-051030-123, ZDB-GENE-051030-123
Description:
carbonic anhydrase-related protein 10 [Source:RefSeq peptide;Acc:NP_001032198]
Human Orthologue:
CA10
Human Description:
carbonic anhydrase X [Source:HGNC Symbol;Acc:1369]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15147 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27946
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074540 Essential Splice Site 46 328 None 9
ENSDART00000133188 None 46 45 None 2
Genomic Location (Zv9):
Chromosome 12 (position 22674983)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21200564
GRCz11 12 21322438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGGATGGTGGGCTTACAAAGAAGTTGTTCAGGGGAGCTTTGTTCCAGG[T/C]AATCATTTTACAACAGCTTTCTTTTGGAGTTCACAAATGATGTTTTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15147
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074540 Essential Splice Site 46 328 3 9
ENSDART00000133188 None None 45 None 2
Genomic Location (Zv9):
Chromosome 12 (position 22756393)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21281884
GRCz11 12 21403188
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATTATTTGATGAATACTGCAAATCATCCCTTTGTGTTTCATCTTGTTGC[A/G]GTGCCATCATTCTGGGGGCTTGTAAATTCAGCTTGGAATCTGTGTTCTGT
Associated Phenotype:
Not determined