Busch Lab

ZMP

si:ch211-106n13.3

Ensembl ID:
ENSDARG00000052633
ZFIN ID:
ZDB-GENE-030131-9088
Description:
hypothetical protein LOC563353 [Source:RefSeq peptide;Acc:NP_001038479]
Human Orthologue:
COL21A1
Human Description:
collagen, type XXI, alpha 1 [Source:HGNC Symbol;Acc:17025]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa15157 Nonsense Available for shipment Available now
sa39942 Nonsense Mutation detected in F1 DNA Not yet available
sa33044 Nonsense Mutation detected in F1 DNA Not yet available
sa14259 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25920
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083654 Nonsense 526 873 11 24
ENSDART00000140294 None None 195 None 5
Genomic Location (Zv9):
Chromosome 2 (position 50613126)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50308658
GRCz11 2 50042888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGCTCTTATAGGGAATCCCAGGGGAGCCAGGAGAAACGGGACCACCCG[G/T]AATTCCCGGATCAAATGTACATAATATGCTTTTAGAATCTCCTCCTGAAT
Long Flanking Sequence:
TTCCTTCTGTTAAACAGAAATTGTGAAAAAAAAACGGGTCTAATAATTCAGGGGGGCTAACAATTCTGACTTTAACTCTATATATGTATGTAGTGATATGTTTATCAAAAGTAGTATATCGATTTTTCTATTTTCCCCCTAATATTTAATAGGGTGAAATGGGACCACCGGGGCCACCGGGGCCACCGGGGCCTTCAGGACCAGAAGTGAGTTTCAAACTTTTTAATAAATGATTTACATTTTCCCTCAATATTATGAATAAAGGTTACGTACAGTAATTTTCTCTTTATAATGAAAAAAAGCAAAAAAATTATTCCATTAAAATCTCCTTTAGGGCACAGGCTTTTCCAAATTGGAGATCCAAGACTTGGGGATTCAAGGAAGCATGGTAAAGTCTTAATAAATCAACTGAAATTGATTACTAACATTAATATTGCTAATAAAAACTGTCGTGCTCTTATAGGGAATCCCAGGGGAGCCAGGAGAAACGGGACCACCCG[G/T]AATTCCCGGATCAAATGTACATAATATGCTTTTAGAATCTCCTCCTGAATGCTCATATCATGCATAAGTGATCATGAGATTTTTTTTCTAATTTACAGTGTTGATTTTTTTTTTGAAAATGGAGGTAAATTTAAATTGAATCGAGACATGTTGACTTATTTTCTGTCTTCCTCAGGGTGAACCTGGGCCACCTGGTCTACCTGGACTTGAAGGTCCGAAGGTAAGACTGATTTTACATTTAAATTGTCTCCTAAACTATAATATAATTAAACTATCATTATTTGTTTATTTATTTTTATTTAGACCGTCACAAAAATGGGGTCATACTAGACACTATAAGCATAACACAGCTTCTGAAACTCTAAAAGTGCTTTTTTTGGTGCACTGCAAAAAATTATTTGCTTGCCTTGATTCTTTGACTTCAAATATCTTGAAATTCTTAAAACAAGAAGCATTTTCTAGACAAGTAAAAAAGTCTTGTTTTAAGAAATAATAGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15157
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083654 Nonsense 567 873 14 24
ENSDART00000140294 None None 195 None 5
Genomic Location (Zv9):
Chromosome 2 (position 50589056)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50284588
GRCz11 2 50018818
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TKGGATTCAAAACTGTACTTAAAGTGTGTSTTTGTGGTTTTAGGGTAWAC[G/T]AGGGCTTCCTGGAGAGATGGGGCCTGCWGGAGCTCAAGTAAGAACCYARA
Long Flanking Sequence:
ACTGAAAGTTAACTCTACTCATTTGAAAAGAGTTTTGAACTCAGTGTTAAAGGTAATGAGTTAATTAAATACCTCATTACTTCAACTTAAATGGAGTGAGTTCACTGTACTCATATAGATAAGGTTTTTTTTTTAACTCAAATGGTTTGTTGCAATCGGTTTCCTGAAACAGTTTGGTCCACTGGGTTTTACAGTACTCAGTTGGTTTGAGTTCTCTTCATTCATTGGATTTTACTGTACTCAACTTGTTTTTGCAAATGGGTAAGTTCACAGTACTCATTAGGATTAATTTTTGAACTTAAATGGTTTGAGTTACCTTAACTTTATGGGTTTTAAAGTGTACAAATTTTAACAAGTTTGCCACTAGATCAAAAAGTTAAAAACTGACAAGACATTGTTGATATTTGATGGTAATTTGACGTTTTATTTTGTGCAATCGGGAAAGTATTATGGGATTCAAAACTGTACTTAAAGTGTGTGTTTGTGGTTTTAGGGTATAC[G/T]AGGGCTTCCTGGAGAGATGGGGCCTGCTGGAGCTCAAGTAAGAACCCAAAATATAACTGAAAATATTAAGTATACATACAATTGCTGTTAATATTGCTTAATAATTATGTACAGGATGTCTTTAATTGCAATACCATTAAAAAAACTAGCAGAAAATGATCAGTTTTCAACTTTCTACATGATAATATTTGTAATTGAATTTGGGATGAATTGCTCTTATACATTTAGAATGAAACAAACATTAGCATTTTACTCAAATCCATATCTAATAATCCAGGGGTGTCAAACTCTGGAGGGCCGCAGCTCTGCACAGTTTAGTTTCTGCCCTGCTTCAACACAATTATCTGTAGGCATCTGTTACAAAGCCCTGATGTTAGTCGAGGGTTGTGGGGTTTGACATTTATTTAATTAAAATATATTTATATAAACAGTGAATGAGTGGAAAGACAACCAACGTAATGCCAAAAAATGTGTGCTTTTATTTACAATCCCAAAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39942
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083654 Nonsense 645 873 18 24
ENSDART00000140294 None None 195 None 5
Genomic Location (Zv9):
Chromosome 2 (position 50571048)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50266580
GRCz11 2 50000810
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGGTTAAATGCCATCATTTTATATTTGCAGGGTGAATCCGGATCATTG[G/A]GACCGAAAGGAAGTCAGGTATAGTGTGATCGACATCTGTGACATTTAATT
Long Flanking Sequence:
CATTCACACTAATTTTTATAATCACATGATGTCTTAAAACAAAATCACATCACCTTTTTAATGCACATACTGGAATTTGTTCAGTAAAAGTGTTTCCATTATAGTTTATGCGCATCTTTTCTTATCAAATAAGCAAATAAGACGTTTATCCTACTCATTTATGCGCATACGTTTTAGGCACATTTTAAAAATATATGCGCATCTTGACGTTTCCATAAGCCGTTTTTTTATGTGCATCACCAAAATGCACATAACGATAGGTGGATGGAAAATAGCTAGTGAGAAAGCATCTTTAGGCAAAGAAAATGGGCAATATTTTTTTCAGAATAAGCATTGAGCGTGCATATTTTAAATTAAAATTTGCCAAATTACTGTTAATTATTGCAATCTCGACAAAATCTTTGCATTTGATAGTTTTATTCAAAATACTTTATTATTTTTTTTCTTCTGCATGGTTAAATGCCATCATTTTATATTTGCAGGGTGAATCCGGATCATTG[G/A]GACCGAAAGGAAGTCAGGTATAGTGTGATCGACATCTGTGACATTTAATTTCCCTTTGTTGAAAAGAAACATGTTCTGAGAGAGAAAAGAGGAAGTGAAAAAAAAAAGGTGTTACTGCCGTTGCGTTTTCCATAACATGAATTATTATGACATACCAGCTGTTCTACATTGGTTTTACTTGTAAAAGCTGACCTATTCTGGAACTGCACACTCTGTTGTAGTAAGAAAGCGAAGCAGACTGGTTGATCTTGTGTTTTTTTTAATAAGACTAATTATTGCATGCTTGTTTTTCCCCATTATAATACTGTACTGTATATTTTAAAGCATGACAACACTTAAAACTCTTATTTCAGGGCGAGAAAGGAAACCAAGGAGAACCTGGAGTCAATGGAAAACATGTATGTATTTATTCTTCCTTAGTGATGTTGGTAATGCAAGCATACTATTAGATATGAGTTTGAATATCTTTGTAAAACCTACGCCTTAAGCTTTGATGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33044
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083654 Nonsense 725 873 22 24
ENSDART00000140294 Nonsense 47 195 3 5
Genomic Location (Zv9):
Chromosome 2 (position 50560418)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50255950
GRCz11 2 49990180
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGAACTGTCTCTTTAAGAAGCGATATTCCCTTAACAGCCCAGCTGCCA[C/T]AGCTCCTGCAGGCAATGGAGCAAAGAAGCTGCCAGCACTGTGAGACCAAA
Long Flanking Sequence:
TGAATGAATGATTATGGAAATTAGCTTCTTTGTTGCAGTTCTTTAATTTGTACATTGTCAGCAGAAATACTCATAGATCTTGGCACCCATCTGCTCTTTTATACAATTGCAGTCTCTCGCTATTTATTTTGCCCCGTTTAGCAAATCTGTTTGCTATTCTAATGCCAGATACCAGTCAAAAAGGGATAAGTCACCCAAAAATGTAAATGACCTCATCATCTGATATGTTTTTTTTCTTCTGTTGAACACAAAAGAAGATACTGTAAGTACTGTATGCTTGTATCTGGCGCCCATTGACTTCCATAGTAGGAAACATATTACATAGCAAGTCAATATGTACCAACATCAACCAGCATTCTTCAAAATATCTTATTTTGAGTCCAATGGAAGAAAGAAACTCAAATAGGTAATAGGGGAAGGGTGAGTAAATGATGACAGATTTGACTTTTGGGTGAACTGTCTCTTTAAGAAGCGATATTCCCTTAACAGCCCAGCTGCCA[C/T]AGCTCCTGCAGGCAATGGAGCAAAGAAGCTGCCAGCACTGTGAGACCAAACGAGGGCCAGCAGGCGATCCAGGTCCCCCAGGCCCAACGGGCCCATCTGGACCACCAGGGTATCCTGGCAGGGCAGGGTCTCCAGGATATCCAGGACCTCCGGGCAGCAGAGGGCCTGAGGGAGTCAAAGGTGATTATACTGTGATTATAAATTCACAGGAAGATTAGAGACAAGTACTAAAACGATTTGATGTTTTTCTTATAGGTGATATTGGTCCGATGGGTATAAAAGGTGCTAAAGGACAGGGTGAAATTGGGTTGCCAGGTCCACCTGGCCAACAAGGTAAAAAAATAAATAGAAAATACTAATGCATGACAGTAGTTATTTATTATTATTATTATGGTCACTTTATTTTAAGGTACAGTTCTCGCTTCATAACAAACCATTAACTAATGCTGCGTCCCAATTCGCATACACATACTAAGCCCTAAAAGTATGTACTTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14259
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083654 Essential Splice Site 785 873 22 24
ENSDART00000140294 Essential Splice Site 107 195 3 5
Genomic Location (Zv9):
Chromosome 2 (position 50560236)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50255768
GRCz11 2 49989998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGGATATCCAGGACCTCCGGGCAGCAGAGGGCCTGAGGGAGTCAAAGG[T/G]GATTATACTGYGATTATAAATTSACAGGAAGATTAGAGACAAGTACTAAA
Long Flanking Sequence:
GGGATAAGTCACCCAAAAATGTAAATGACCTCATCATCTGATATGTTTTTTTTCTTCTGTTGAACACAAAAGAAGATACTGTAAGTACTGTATGCTTGTATCTGGCGCCCATTGACTTCCATAGTAGGAAACATATTACATAGCAAGTCAATATGTACCAACATCAACCAGCATTCTTCAAAATATCTTATTTTGAGTCCAATGGAAGAAAGAAACTCAAATAGGTAATAGGGGAAGGGTGAGTAAATGATGACAGATTTGACTTTTGGGTGAACTGTCTCTTTAAGAAGCGATATTCCCTTAACAGCCCAGCTGCCACAGCTCCTGCAGGCAATGGAGCAAAGAAGCTGCCAGCACTGTGAGACCAAACGAGGGCCAGCAGGCGATCCAGGTCCCCCAGGCCCAACGGGCCCATCTGGACCACCAGGGTATCCTGGCAGGGCAGGGTCTCCAGGATATCCAGGACCTCCGGGCAGCAGAGGGCCTGAGGGAGTCAAAGG[T/G]GATTATACTGTGATTATAAATTCACAGGAAGATTAGAGACAAGTACTAAAACGATTTGATGTTTTTCTTATAGGTGATATTGGTCCGATGGGTATAAAAGGTGCTAAAGGACAGGGTGAAATTGGGTTGCCAGGTCCACCTGGCCAACAAGGTAAAAAAATAAATAGAAAATACTAATGCATGACAGTAGTTATTTATTATTATTATTATGGTCACTTTATTTTAAGGTACAGTTCTCGCTTCATAACAAACCATTAACTAATGCTGCGTCCCAATTCGCATACACATACTAAGCCCTAAAAGTATGTACTTTTTTGTGAAGGAAAAATATTTACTTTTGAATGTGTAACAAGAATATGCTAGCTTTGGGACATACTACTTCCTCGTTAACAGATCGCTACGTTGCTTAGTTATGAGCCCTGTCAATCATCCACATTTCTGTCATATTTCATTTCCTACCTTATTGGAGAAGCAGCAGCAGGTTAATCTGCCATTCACAA
Associated Phenotype:
Not determined