Busch Lab

ZMP

raver1

Ensembl ID:
ENSDARG00000052617
ZFIN ID:
ZDB-GENE-050522-99
Description:
ribonucleoprotein, PTB-binding 1 [Source:RefSeq peptide;Acc:NP_001018503]
Human Orthologue:
RAVER1
Human Description:
ribonucleoprotein, PTB-binding 1 [Source:HGNC Symbol;Acc:30296]
Mouse Orthologue:
Raver1
Mouse Description:
ribonucleoprotein, PTB-binding 1 Gene [Source:MGI Symbol;Acc:MGI:1919016]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20124 Nonsense Available for shipment Available now
sa9586 Nonsense Available for shipment Available now
sa9053 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20124
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040083 Nonsense 112 312 2 4
ENSDART00000127832 Nonsense 112 725 2 14
ENSDART00000146189 Nonsense 112 322 2 3
Genomic Location (Zv9):
Chromosome 3 (position 46600856)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48610409
GRCz11 3 46562743
KASP Assay ID:
2259-4020.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGTGACTGAAATCTTGCTGTTTTTTTTGTAGGAGGTTCATGAGCTGT[T/A]GGGCAACTATGATTTAAAGTACTGCTTTGTGGACAAATACAAAGGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9586
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040083 Nonsense 180 312 3 4
ENSDART00000127832 Nonsense 180 725 3 14
ENSDART00000146189 Nonsense 180 322 3 3
Genomic Location (Zv9):
Chromosome 3 (position 46604520)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48614073
GRCz11 3 46566407
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGACGCTCTGCTCTGCATCGCCAACCTTCCCAGGGCGTTCACTCAGCAA[C/T]AGTTCGAGGAGCTAGTTCGGCCCTTCGGAAACATTGAGCGCTGCTTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9053
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040083 None None 312 None 4
ENSDART00000127832 Splice Site, Nonsense 421 725 6 14
ENSDART00000146189 None None 322 None 3
Genomic Location (Zv9):
Chromosome 3 (position 46618339)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48627892
GRCz11 3 46580226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCTCTCTCTGCTGCCCTGATGCAGATGCTGCTTCAGAACCAAGTCCAA[C/T]AGGTACAATGCTGACCTCTCTTTCCACCTCTTATAAACTGCCACTCTCCC
Associated Phenotype:
Not determined