Busch Lab

ZMP

arl13a

Ensembl ID:
ENSDARG00000052575
ZFIN ID:
ZDB-GENE-040426-1790
Description:
ADP-ribosylation factor-like 13A [Source:RefSeq peptide;Acc:NP_957112]
Human Orthologue:
ARL13A
Human Description:
ADP-ribosylation factor-like 13A [Source:HGNC Symbol;Acc:31709]
Mouse Orthologue:
Arl13a
Mouse Description:
ADP-ribosylation factor-like 13A Gene [Source:MGI Symbol;Acc:MGI:1921698]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa14291 Essential Splice Site Available for shipment Available now
sa10478 Nonsense Available for shipment Available now
sa42434 Nonsense Mutation detected in F1 DNA Not yet available
sa42433 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14291
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Essential Splice Site None 409 None 10
ENSDART00000138232 Essential Splice Site 7 434 None 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 42784086)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40941191
GRCz11 14 41308445
KASP Assay ID:
2260-7844.1 (used for ordering genotyping assays)
KASP Sequence:
AATGTCTCTGGAGAAACAAACAAAAACGCATGGAKTCTGACATACTACTG[T/A]RAGTAATGAGTWTATTTAATGTCATTTTGTTGTTTAACTWCTTCATATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19093
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Essential Splice Site 44 409 None 10
ENSDART00000138232 Essential Splice Site 69 434 None 10
ENSDART00000074455 Essential Splice Site 44 409 None 10
ENSDART00000138232 Essential Splice Site 69 434 None 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 42779314)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40936419
GRCz11 14 41303673
KASP Assay ID:
2260-7842.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTTGGACAAGGCAGGAAAAACCTCTTGCGTCAGGGGAATGTTGAGAGG[T/A]AATTTAAATGTATATCAGGTTAGCAGAAATGCTGATTTGACTGCAGCTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4572
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Essential Splice Site 44 409 None 10
ENSDART00000138232 Essential Splice Site 69 434 None 10
ENSDART00000074455 Essential Splice Site 44 409 None 10
ENSDART00000138232 Essential Splice Site 69 434 None 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 42779314)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40936419
GRCz11 14 41303673
KASP Assay ID:
2260-7842.1 (used for ordering genotyping assays)
KASP Sequence:
GGCTTGGACAAGGCAGGAAAAACCTCTTGCGTCAGGGGAATGTTGAGAGG[T/A]AATTTAAATGTATATCAGSTTAGCAGAAATGCTGAWTTGACTGCAGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10478
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Nonsense 226 409 6 10
ENSDART00000138232 Nonsense 251 434 6 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 42775991)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40933096
GRCz11 14 41300350
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGGCCCAGAGGAAAAGGAAAGGAAGGRAAAAATTGAGAAGAGCCGGAAC[A/T]AAACTAAAGAWGAGAAGTAAGGGCTGATWAATATGTCAGTCAGGGCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42434
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Nonsense 315 409 8 10
ENSDART00000138232 Nonsense 340 434 8 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 42772946)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40930051
GRCz11 14 41297305
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACGAAGCAGAACAGGAGCACAACCAGAAGGATAAAGCCAGCAGTGCAT[T/G]ACTGCCTCCGAAACGTGGGAAGCTGAAACGTAAAGCCAAAGTAAAAGAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28354
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Nonsense 357 409 9 10
ENSDART00000138232 Nonsense 382 434 9 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 42769732)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40926837
GRCz11 14 41294091
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTATGCTTTAAAGTTGTGCCTTTTACAGGAAAAGAGGAGAGAAAGAGG[A/T]AAAAAAAGACGGTTAAAGTGAAACGAAAAAACAAGATCAACACGGAGGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28353
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Nonsense 380 409 9 10
ENSDART00000138232 Nonsense 405 434 9 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 42769663)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40926768
GRCz11 14 41294022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAACGAAAAAACAAGATCAACACGGAGGAAGTTCCTGCTGCGTACACA[C/T]AGCCTGTTGATCTGTCCAATACTTTCGGTGAGCATTGGTGACTTCCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42433
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Nonsense 404 409 10 10
ENSDART00000138232 Nonsense 429 434 10 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 42769362)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40926467
GRCz11 14 41293721
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATAGACCTTTACCGAAAAGCTATTTTGGCTCTCAAAGCCCGACAGGAA[C/T]AGGACATGGTCTCGGGATAGTACAGAAAAAGGATCATGGATGCCATGAAG
Associated Phenotype:
Not determined