Busch Lab

ZMP

zgc:112973

Ensembl ID:
ENSDARG00000052553
ZFIN ID:
ZDB-GENE-050706-65
Description:
DNA ligase 3 [Source:RefSeq peptide;Acc:NP_001025345]
Human Orthologue:
LIG3
Human Description:
ligase III, DNA, ATP-dependent [Source:HGNC Symbol;Acc:6600]
Mouse Orthologue:
Lig3
Mouse Description:
ligase III, DNA, ATP-dependent Gene [Source:MGI Symbol;Acc:MGI:109152]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44623 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31480 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44623
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074426 Essential Splice Site 260 752 5 20
Genomic Location (Zv9):
Chromosome 5 (position 62535177)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60170176
GRCz11 5 60854907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGCATACTGAATTGCAATCAGGATGACATGGTGCAAGACTTGGAACAG[G/A]TTTGTAGTGTAGCTTCGAAGGTTTAATTTAGAAAAGAGGAGAGATATTTC
Long Flanking Sequence:
GAGCTTGCGCTACGCGTCGTTGCGACATGTAGTTACATTTTTTTGAGAGGTGCACATCAGCGACGTCGAAGGCCACGGCGTAGGGCTATGTGTCAGCGCTGAGCATACGCCGGCATTTGACGCAGAAGTATAAATCAGCCTTACGCTGCACTGTTTGAGGAAGTTCAACTTGACGAATTCTCTAAAAACAGTATAATCAACAGTAGATAAAAACACAAAGGCTTTAAAAACTGAGTGAGAATAAATTGAGGTCATTTTCATTTTTGGATGAACTAACCCTTTAATATTAACACGAATGAATTATCTCACTGACCCGTTTTAATAAATCTCTCTCCCAAATCTTCACAGACAAATTCAGAGGAGATTTGTACCTGACAGTGAAGCTTCTCCTCCCAGGCGTAGTGAAGAATGTGTACAACCTCAATGACAAACAAATCGTCAAGCTTTTTAGCCGCATACTGAATTGCAATCAGGATGACATGGTGCAAGACTTGGAACAG[G/A]TTTGTAGTGTAGCTTCGAAGGTTTAATTTAGAAAAGAGGAGAGATATTTCACCTTTCTCTCATTGATCTTCATAGGGAGATGTTTCGGAGACGGTGCGGATGTTTTTCGAGGAAAGCAAGTCTTTCCCTCCTTCAGCAAAAAGTCTTCTGACCATCCAAGAGGTGGATGCTTCGCTGAGCCGATTATCCCAGCTCACAAAGGAGGACGATCAGCAGGCAGAGCTGCAGAGCATTGCCAAAAAGTCAGGAAAAGTTCTACATTTGAACTAGGCCTGTCACAATATCTATTATTTGTTGTACAATATATTGTACCAAAATATATTGCGTTAAACGATATTATTGTTATTGTTAAGACCATTTTATGCCACTCACTATATAATGCCAGAATGACAATATAATAGCATTCCAATGCAAGTACACTCTTCCAAAGAACACATAATAATGTATTATTAAGAATATTTAGTTTCATTATAGTAATTAACAATTTAATAATTAGGCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8207
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074426 Essential Splice Site 316 752 6 20
ENSDART00000074426 Essential Splice Site 316 752 6 20
Genomic Location (Zv9):
Chromosome 5 (position 62535421)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60170420
GRCz11 5 60855151
KASP Assay ID:
2259-6658.1 (used for ordering genotyping assays)
KASP Sequence:
TCACAAAGGAGGACGATCAGCAGGCAGARCTGCAGAGCATTGCYAAAAAG[T/G]CAGGAAAAGTTCTACATTTGAACTAGGCCTGTCACAWTATCTATTANNTG
Long Flanking Sequence:
ATTGAGGTCATTTTCATTTTTGGATGAACTAACCCTTTAATATTAACACGAATGAATTATCTCACTGACCCGTTTTAATAAATCTCTCTCCCAAATCTTCACAGACAAATTCAGAGGAGATTTGTACCTGACAGTGAAGCTTCTCCTCCCAGGCGTAGTGAAGAATGTGTACAACCTCAATGACAAACAAATCGTCAAGCTTTTTAGCCGCATACTGAATTGCAATCAGGATGACATGGTGCAAGACTTGGAACAGGTTTGTAGTGTAGCTTCGAAGGTTTAATTTAGAAAAGAGGAGAGATATTTCACCTTTCTCTCATTGATCTTCATAGGGAGATGTTTCGGAGACGGTGCGGATGTTTTTCGAGGAAAGCAAGTCTTTCCCTCCTTCAGCAAAAAGTCTTCTGACCATCCAAGAGGTGGATGCTTCGCTGAGCCGATTATCCCAGCTCACAAAGGAGGACGATCAGCAGGCAGAGCTGCAGAGCATTGCCAAAAAG[T/G]CAGGAAAAGTTCTACATTTGAACTAGGCCTGTCACAATATCTATTATTTGTTGTACAATATATTGTACCAAAATATATTGCGTTAAACGATATTATTGTTATTGTTAAGACCATTTTATGCCACTCACTATATAATGCCAGAATGACAATATAATAGCATTCCAATGCAAGTACACTCTTCCAAAGAACACATAATAATGTATTATTAAGAATATTTAGTTTCATTATAGTAATTAACAATTTAATAATTAGGCATTGGAATTAGAATGTAAAAATGCTTATTCTAAACAAATAAATATTAATAAATGTTAACAAAAAAGTCCAAGGTAAAAACACTGCAATATCTGATACTATTTTTAGTTGTCAGACACCCTCATGAAAATATACTATGATCATTTATAGTAAATACTATAGTTTTTTTTTTTTTTAACTATAGTGACACTTACACCTCTAACAGAGATAGAGATGTTACACAATCAGCTAAAATGTTGCTTTTTTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18822
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074426 Essential Splice Site 316 752 6 20
ENSDART00000074426 Essential Splice Site 316 752 6 20
Genomic Location (Zv9):
Chromosome 5 (position 62535421)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60170420
GRCz11 5 60855151
KASP Assay ID:
2259-6658.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACAAAGGAGGACGATCAGCAGGCAGAGCTGCAGAGCATTGCCAAAAAG[T/G]CAGGAAAAGTTCTACATTTGAACTAGGCCTGTCACAATATCTATTATTTG
Long Flanking Sequence:
ATTGAGGTCATTTTCATTTTTGGATGAACTAACCCTTTAATATTAACACGAATGAATTATCTCACTGACCCGTTTTAATAAATCTCTCTCCCAAATCTTCACAGACAAATTCAGAGGAGATTTGTACCTGACAGTGAAGCTTCTCCTCCCAGGCGTAGTGAAGAATGTGTACAACCTCAATGACAAACAAATCGTCAAGCTTTTTAGCCGCATACTGAATTGCAATCAGGATGACATGGTGCAAGACTTGGAACAGGTTTGTAGTGTAGCTTCGAAGGTTTAATTTAGAAAAGAGGAGAGATATTTCACCTTTCTCTCATTGATCTTCATAGGGAGATGTTTCGGAGACGGTGCGGATGTTTTTCGAGGAAAGCAAGTCTTTCCCTCCTTCAGCAAAAAGTCTTCTGACCATCCAAGAGGTGGATGCTTCGCTGAGCCGATTATCCCAGCTCACAAAGGAGGACGATCAGCAGGCAGAGCTGCAGAGCATTGCCAAAAAG[T/G]CAGGAAAAGTTCTACATTTGAACTAGGCCTGTCACAATATCTATTATTTGTTGTACAATATATTGTACCAAAATATATTGCGTTAAACGATATTATTGTTATTGTTAAGACCATTTTATGCCACTCACTATATAATGCCAGAATGACAATATAATAGCATTCCAATGCAAGTACACTCTTCCAAAGAACACATAATAATGTATTATTAAGAATATTTAGTTTCATTATAGTAATTAACAATTTAATAATTAGGCATTGGAATTAGAATGTAAAAATGCTTATTCTAAACAAATAAATATTAATAAATGTTAACAAAAAAGTCCAAGGTAAAAACACTGCAATATCTGATACTATTTTTAGTTGTCAGACACCCTCATGAAAATATACTATGATCATTTATAGTAAATACTATAGTTTTTTTTTTTTTTAACTATAGTGACACTTACACCTCTAACAGAGATAGAGATGTTACACAATCAGCTAAAATGTTGCTTTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31480
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074426 Essential Splice Site 342 752 7 20
Genomic Location (Zv9):
Chromosome 5 (position 62537970)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60172969
GRCz11 5 60857700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCGTTTGGTCAAACATGATTTGAAAATCAACTCAGGGGCGAAACACATG[T/A]AAGTGATGCTAGCAAATTGTTTTTAAGACGACTGGTACTAAGATACATTT
Long Flanking Sequence:
GGTCACCGAACTCACTGCTGTTTACTGAGTGTAAACACAGATACAGGCACACTGAAGCATTTTAAAGCCACAATTCATTAGCTGATCTCTTGTATGTCAGCTTATAGACAAACCAGCTGATCGAGCTGGCTTTAAAATGCTCCAGTGTCCCTGTATGTGTGTTCACACTCAGTAAACAGCGGTGAGTCAATCACAGTCATCTTTGTTGAGAACATAAACACAATGACAAATCAGTGCTGTTCAAGAACATGCTAAACAGCGCTCAAATGTTAGCAGGATATGGACGTTTTTAAAATTTTAGTATCATGACAGCACTATAACATGGTGAAACTTATTTTCTTGAAAATATGGTGTACAAAATTGGTTTTCAGTCTGTTTAACTTAAAGCACACTCACCTTAAATGTATTTCTTGATTACCAGATGCACCGGGAATGATCTGAAGTGCTACATTCGTTTGGTCAAACATGATTTGAAAATCAACTCAGGGGCGAAACACATG[T/A]AAGTGATGCTAGCAAATTGTTTTTAAGACGACTGGTACTAAGATACATTTTTGATCGGTTCACAGGTGGACTTTCTAAAGTAACTGTTCAAGTAGAGTCTGAAACATTTTAAGCTTATTCACTTTCTACCATGTCCAAAAGTCAGAAACGCATCCAACTGTTTTGCTTTCATAGAATAAACACTTATTTGAACAGATGCATTTAAACAGCCAATAAGGACCTACTCTGTGTATAGTCCATTTTTAACAGTATAGGAATTGTTAAAGGTCCTGTGAAGTGCTTTGCAATTTGCATTTTTTTTCAATGTTTGGATTAATCTCAACTGAAACATGAAAACAGAGTGGGACATATAGTAGCTCCTCCTCTGAAAAATAAACAACCAGTTGTGTTAGGGTTTATTGGTTTAATTAAAATAATAAAATATAAAAACAAATAAGAGGCATCTTAAAGAAGCGGGGCATGTTAGATACTATAGAACATGTGATTGGTCAGAAGATTTG
Associated Phenotype:
Not determined