Busch Lab

ZMP

LIN28B

Ensembl ID:
ENSDARG00000052511
Description:
lin-28 homolog B (C. elegans) [Source:HGNC Symbol;Acc:32207]
Human Orthologue:
LIN28B
Human Description:
lin-28 homolog B (C. elegans) [Source:HGNC Symbol;Acc:32207]
Mouse Orthologue:
Lin28b
Mouse Description:
lin-28 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:3584032]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37157 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37157
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113412 Essential Splice Site 3 123 1 3
Genomic Location (Zv9):
Chromosome 20 (position 47707763)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47521136
GRCz11 20 47490626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCGCTGGAACTTTGGAACGGAGGGTCCGCGGGGAAACATGGCCGAAG[G/A]TTACGATGCTTTTTTTATTCTTTTTTTCCGCGTTCACGTGGGAAGTCCTA
Associated Phenotype:
Not determined