Busch Lab

ZMP

arhgef11

Ensembl ID:
ENSDARG00000052482
ZFIN ID:
ZDB-GENE-070604-1
Description:
rho guanine nucleotide exchange factor 11 [Source:RefSeq peptide;Acc:NP_001027010]
Human Orthologue:
ARHGEF11
Human Description:
Rho guanine nucleotide exchange factor (GEF) 11 [Source:HGNC Symbol;Acc:14580]
Mouse Orthologue:
Arhgef11
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 11 Gene [Source:MGI Symbol;Acc:MGI:2441869]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa26876 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20855 Nonsense Available for shipment Available now
sa15205 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa26876
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017140 Essential Splice Site 32 1406 None 40
ENSDART00000136594 Essential Splice Site 43 524 None 19
Genomic Location (Zv9):
Chromosome 7 (position 6314828)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5349166
GRCz11 7 5470813
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGGCCAGCAGAGGGAAACACTGCCTGATCTCTCTTCAGACAACACCGG[T/C]AATGCAGATTTCTGTTACAAGCACATTTACACTGGGCATGCGCCAGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20855
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017140 Nonsense 35 1406 2 40
ENSDART00000136594 Nonsense 46 524 3 19
Genomic Location (Zv9):
Chromosome 7 (position 6311663)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5346001
GRCz11 7 5467648
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTACTCATCTTTATATTTTCTGTTCCTCCTGATTTGACAGGAACGGGTT[T/A]GGTCCAAAGATGCGTGGTCGTGCAGAGGGACAATCTGGGGTTTGGCTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18863
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017140 Essential Splice Site 226 1406 7 40
ENSDART00000136594 Essential Splice Site 237 524 8 19
Genomic Location (Zv9):
Chromosome 7 (position 6301478)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5335816
GRCz11 7 5457463
KASP Assay ID:
2259-8401.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCCAAACGAAGAGCCAGTCAGGTCAGAGTGAAGATCCAGCAGGACGTG[G/T]TGAGGATTTGCATATTAATGATACAGCAGCTGTTGATGCATGAACTCTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26875
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017140 Nonsense 237 1406 8 40
ENSDART00000136594 Nonsense 248 524 9 19
Genomic Location (Zv9):
Chromosome 7 (position 6298135)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5332473
GRCz11 7 5454120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTTTTTTTATCAGGACGGCACTCGATCAGATGCAGTCGCTAACTA[T/A]CTCACAGCAGGAGAAGGTCAGTGTTATAGTAAAGGTATATGTTGAGGAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8256
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017140 Essential Splice Site 374 1406 13 40
ENSDART00000136594 Essential Splice Site 385 524 14 19
Genomic Location (Zv9):
Chromosome 7 (position 6292360)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5326698
GRCz11 7 5448345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGGTCACTCGCCCCGCAGATCTGCTCACACTTCCTGGACCATGATGCTG[T/A]GCGTATCTCAACTACACCATAGTTTTCACGTGTTGTCRTATCATTAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15205
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017140 Essential Splice Site 801 1406 26 40
ENSDART00000136594 None None 524 None 19
Genomic Location (Zv9):
Chromosome 7 (position 6256699)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5291127
GRCz11 7 5412843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAGAATCAGTGATMGTTCAGGGCATTGGAGACATCATGCTGGCCAGAG[T/C]GAGTCTCATTTCTCTGTCTTCATCTCWGGATTTCKGTCTGTGTTGGTGAA
Associated Phenotype:
Not determined