Busch Lab

ZMP

hrh1

Ensembl ID:
ENSDARG00000052425
ZFIN ID:
ZDB-GENE-070531-3
Description:
histamine H1 receptor [Source:RefSeq peptide;Acc:NP_001036196]
Human Orthologue:
HRH1
Human Description:
histamine receptor H1 [Source:HGNC Symbol;Acc:5182]
Mouse Orthologue:
Hrh1
Mouse Description:
histamine receptor H1 Gene [Source:MGI Symbol;Acc:MGI:107619]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41753 Nonsense Mutation detected in F1 DNA Not yet available
sa21825 Nonsense Available for shipment Available now
hu3427 Nonsense Confirmed mutation in F2 line Not yet available
sa38817 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41753
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074283 Nonsense 405 534 1 1
Genomic Location (Zv9):
Chromosome 11 (position 892637)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 874584
GRCz11 11 901082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTGGGGAACATCTGCGAGAGTGCGCCGACTGTAGATATCCATAATTA[C/A]ACCGCAGTTCTGTGTACGCCACCTTCGCCGCCGTCTCCGTGGGCTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21825
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074283 Nonsense 444 534 1 1
Genomic Location (Zv9):
Chromosome 11 (position 892522)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 874469
GRCz11 11 900967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCTAGTATTGCGCTACCTGCGAAGCAATCATGGCAGAAACTCTGCGAA[C/T]AATCCAAGCAGAGCATTCACAGCATGCGCATCCGCAAGGAGAGGAAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3427
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074283 Nonsense 456 534 1 1
Genomic Location (Zv9):
Chromosome 11 (position 892486)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 874433
GRCz11 11 900931
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAACTCTGCGAACAATCCAAGCAGAGCATTCACAGCATGCGCATCCGC[A/T]AGGAGAGGAAAGCGGCGCGCCAGCTGGGCTTTATCATCGGCGTCTTCATG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa38817
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074283 Nonsense 524 534 1 1
Genomic Location (Zv9):
Chromosome 11 (position 892282)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 874229
GRCz11 11 900727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCCACGCTCAATCCCTTCATTTACCCGCTCTGCAACGAAAACTTCAAA[C/T]GAGTGTTCAAGAAGATCTTTCATATGAGTAGATAGAGTTGTGAAGAGTGT
Associated Phenotype:
Not determined