Busch Lab

ZMP

ankrd12

Ensembl ID:
ENSDARG00000052419
ZFIN ID:
ZDB-GENE-040426-846
Description:
ankyrin repeat domain 12 [Source:RefSeq peptide;Acc:NP_956444]
Human Orthologue:
ANKRD12
Human Description:
ankyrin repeat domain 12 [Source:HGNC Symbol;Acc:29135]
Mouse Orthologue:
Ankrd12
Mouse Description:
ankyrin repeat domain 12 Gene [Source:MGI Symbol;Acc:MGI:1914357]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa8899 Nonsense Mutation detected in F1 DNA Not yet available
sa19905 Nonsense Available for shipment Available now
sa25937 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available
sa11738 Nonsense Available for shipment Available now
sa33058 Nonsense Available for shipment Available now
sa6870 Nonsense Mutation detected in F1 DNA Not yet available
sa19906 Nonsense Available for shipment Available now
sa44551 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8899
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270 Nonsense 46 424 3 10
ENSDART00000097864 Nonsense 46 1987 2 12
ENSDART00000146037 None None 71 None 6
Genomic Location (Zv9):
Chromosome 2 (position 55360326)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55025325
GRCz11 2 54758264
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAAACTCCGAAGCTGGATYGGAGTGAACTCTTGGGGAAAGAGGGGAAGT[C/A]GAAATCCTCCATGAAGCGGAAACTCTCYTTCACTGKCAGTCCATCCCGAA
Long Flanking Sequence:
TATATATATATATATATATATATATATATATATATATATATATATATATATATAAACAGTGAAAAACTTTGGCAGGACAAGTAAAAATCTGAACCACTGGCCCGATTGGGCCTGTAGAAAAAATCCTTAGCGTTGAACCCTGAATATAATCCAATATAATTTTAGTAAACTTAATAGCACAAAAATATTGCAACGCTTTTAAATTGAAATTGAAATTGAATTTTAAAATGGAAAACTTCAGTACAAACACGTTGTGCACATTTAAATGATCTGAGATATATCAATCATAATAAGCAATTCCAGCGTTATGGATGTGACATTTGCAGTAAAAACTCAAAACTTAAATTCACAGATATTAGTGATTCTTTTGTGTACAATTTTTTTTTGAATAAAATGTGTGTCCAATTCTTCCTGTCTCTCTCAGAGTAAAGAGAAAATCTCTCCGTTTGCTAAAACTCCGAAGCTGGATCGGAGTGAACTCTTGGGGAAAGAGGGGAAGT[C/A]GAAATCCTCCATGAAGCGGAAACTCTCCTTCACTGTCAGTCCATCCCGAAACGAGGAGCGCGACTCGGATGCAGGTCAGTTTCACACTCTCTAAAGGGTTTGTTTTTAATGTAATCTCTGTATGTACTCACTGAATGTTCTGGTAGCTCGTGTTCGTGCCTCACTGACGCCCCCTAGTGATCACTTTTTTATTGCACACACTGTACTGTTGAAGGGTTTTCGAGAGGGTTATATAACGGTTAGGCTAAACTTGCTTAATTCACGAGTCCACCTCGAAAATGCAGGAAAAATACAGTATGAGGGAGTGGTGAATGTTTATCTTTTTATTATTATATTTAAATGACTTAATTTAGTTGACTAATTTAAATGCAAATACTTTAATACTGGTGATTCACACAGTATAAGAATACATTCATTATATTATACAATACATACAATTATTATAGTAATGAAAGTAATTTTTTGTTTCATGTGAATGCAAATACTCTAATACTGTTGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3407
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270 Nonsense 78 424 4 10
ENSDART00000097864 Nonsense 78 1987 3 12
ENSDART00000146037 None None 71 None 6
Genomic Location (Zv9):
Chromosome 2 (position 55363708)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55028707
GRCz11 2 54761646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCTGCGNNCTCTGCTTCTGCCCTGTAGATGACTCTGACCCGGGGCAGT[C/A]GAGCGATGCRTGGGGAGAGAGATTACTTCCTCCCTGCAGGATATACGCAG
Long Flanking Sequence:
TCCAATCTGTAGCTTTTCGTCGTTGTTGTTGTTGTTGTTGTTATTATGATAATTACTATTATTATTTTTTTTCAATCTGTAGCTTTTCATTATTATTATTATTATTATTATTATCATTCATTTTGGACTTATAGAATTTTATCTACTTTTTATATATTGATATAGGAAAATTTTCAATTATGACAGTTAGTTTAGTTACAAACAAATACTGTAGTGTTTCATTTTTATTTATTTAATCATTTATTTATTGACCTATCTGATTATGTGGTCAGTCATATTTTATAATTTTATTTTTGTGGTCCCATTATTTGAATCGAATTCTCAGTGACTCTTGAATATTCATCCCGGAGTCTTTGAATTCTGTGCTGTGATTTGTGGTTTGAGTGAGGGGGGCGGGGCCTGTGGGTGCAATCAGTGCTCTGCTCTCCTCTCGAACCCTGAACCTCTGTCCTCCTGCGCTCTCTGCTTCTGCCCTGTAGATGACTCTGACCCGGGGCAGT[C/A]GAGCGATGCGTGGGGAGAGAGATTACTTCCTCCCTGCAGGATATACGCAGGTAAAGGCTAGTCCGAGATGCCTCACGCTCCCGCTCTGTCTTCAGTTCTTTCTCTAAGGCTACGTTTACACTAGTGCATTTTTATTTTTAACATACACACTCAAAAGAATGAAACTGTTTGCTGTTTGTTCAAAGTACTTATTTAAATTCAAGCTGAAACAATACAGTTCTTGAGGTTTTCTTTTTTAAGTGTCAACTTATGTTCGATCCAATTTATAAAAACTATTATGTTAACTTAATTCCTTCATGTTATCCCAACAAAAATAAATTGTTTAGAGCCCAGCAATTTTTGGTGCAGTGTTCAGCATAAATGAGAACACCCCCTTTTTAAAAAATTATTTTCCCATCCATTTCCTTTTGCATTTAAAGGCCCGTGAAATTAAAATAATGTTTTTCAGATGTTAGTTTAAGTCTGCTAGTTTTAAGGATATCTATAAGCTAGTATTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19905
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270 None None 424 None 10
ENSDART00000097864 Nonsense 793 1987 8 12
ENSDART00000146037 None None 71 None 6
Genomic Location (Zv9):
Chromosome 2 (position 55377801)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55042801
GRCz11 2 54775740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATGAGCGGACTGATGGTACTTTCTCTGTACGAATTCCTGATGGCTCA[C/T]AACACTTGTCAGAAGAAGTGGATGAGAAACCAGCAACTTGTAATTCGGCT
Long Flanking Sequence:
TAAGCAACAGTATAGACAGCTCTGAGGGTGCGTTTAGGAAGACTGACAAAGATGGGAAAGTTGTAAAAAAGCACAAGCTAAAACACAAGGAGAAGGAAAAGGAGAAATATAGGAAAGAGTACGAGGCAGAGAGGAATCGCCACCGGCAGAAAGAGCCACGCAAGGACGGACATAGAAACCTCGAGTTTGATCGAGAGTTCTGGAAGGAGAACTTCTTCAAAAGTGATGAAAATGAGGAACCTGTGGGCAAAGGTGAGATACCTGCTGGTGGATCTCCAGTAAAATCCTCAGATTCGTCACCTGTTAAAGAGGAAAAAGGGGCATCAAAAGACAAACATTCAACTAGTAGCAGTAACAAGGACAGGAGGCCAAAAGAGGAAAGAGATAAAACCATTAAAAAGGAGAAAAAAGAGATTCCTCTTAAAGAGGAGCGAGGAAAAGAAGATGAAACAGATGAGCGGACTGATGGTACTTTCTCTGTACGAATTCCTGATGGCTCA[C/T]AACACTTGTCAGAAGAAGTGGATGAGAAACCAGCAACTTGTAATTCGGCTGACCAAGAGCAACTGGAGTCTCCAGAGAAGAACTCTCGAGAAAAAACTGATAAGCGACCACCAACAAAGGATCGGGAATCTGAGAAGTCTGATAAGAGACACTCGGATAAAGATAAGAAGGTAAAATCTGAGCATTTAGCTGACAAGCCTGAGCTCCACAACTCTACAGATCGATGGAAGGAAAAGGAGAAATTAACAAATGTTTCATATTCGCCCAATGATAAGAGCCATAAAGAGGGTGAAAAACTCAAACCAATGACTCCAGTGAAAAAGCATGAGGAGAACAAGAAGAATAAGGACAAGCTTGATAAAAAAGCGGAGAAAGAGCACGCTTCTGGTGACCACAGAGACAAAGATAAAACAACTTCTGAAAAGAAAGGAAAAGCTCCTGAGAAAACTGCTGATCATGGAAAATCTGACCGCAGTAAAGACAAAGAACGGGACAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25937
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270 None None 424 None 10
ENSDART00000097864 Missense 799 1987 8 12
ENSDART00000146037 Essential Splice Site 21 71 2 6
Genomic Location (Zv9):
Chromosome 2 (position 55377819)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55042819
GRCz11 2 54775758
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACTTTCTCTGTACGAATTCCTGATGGCTCACAACACTTGTCAGAAGAA[G/A]TGGATGAGAAACCAGCAACTTGTAATTCGGCTGACCAAGAGCAACTGGAG
Long Flanking Sequence:
GCTCTGAGGGTGCGTTTAGGAAGACTGACAAAGATGGGAAAGTTGTAAAAAAGCACAAGCTAAAACACAAGGAGAAGGAAAAGGAGAAATATAGGAAAGAGTACGAGGCAGAGAGGAATCGCCACCGGCAGAAAGAGCCACGCAAGGACGGACATAGAAACCTCGAGTTTGATCGAGAGTTCTGGAAGGAGAACTTCTTCAAAAGTGATGAAAATGAGGAACCTGTGGGCAAAGGTGAGATACCTGCTGGTGGATCTCCAGTAAAATCCTCAGATTCGTCACCTGTTAAAGAGGAAAAAGGGGCATCAAAAGACAAACATTCAACTAGTAGCAGTAACAAGGACAGGAGGCCAAAAGAGGAAAGAGATAAAACCATTAAAAAGGAGAAAAAAGAGATTCCTCTTAAAGAGGAGCGAGGAAAAGAAGATGAAACAGATGAGCGGACTGATGGTACTTTCTCTGTACGAATTCCTGATGGCTCACAACACTTGTCAGAAGAA[G/A]TGGATGAGAAACCAGCAACTTGTAATTCGGCTGACCAAGAGCAACTGGAGTCTCCAGAGAAGAACTCTCGAGAAAAAACTGATAAGCGACCACCAACAAAGGATCGGGAATCTGAGAAGTCTGATAAGAGACACTCGGATAAAGATAAGAAGGTAAAATCTGAGCATTTAGCTGACAAGCCTGAGCTCCACAACTCTACAGATCGATGGAAGGAAAAGGAGAAATTAACAAATGTTTCATATTCGCCCAATGATAAGAGCCATAAAGAGGGTGAAAAACTCAAACCAATGACTCCAGTGAAAAAGCATGAGGAGAACAAGAAGAATAAGGACAAGCTTGATAAAAAAGCGGAGAAAGAGCACGCTTCTGGTGACCACAGAGACAAAGATAAAACAACTTCTGAAAAGAAAGGAAAAGCTCCTGAGAAAACTGCTGATCATGGAAAATCTGACCGCAGTAAAGACAAAGAACGGGACAAAGATTCTGACAAGAGGAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11738
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270 None None 424 None 10
ENSDART00000097864 Nonsense 1106 1987 8 12
ENSDART00000146037 None None 71 2 6
Genomic Location (Zv9):
Chromosome 2 (position 55378741)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55043741
GRCz11 2 54776680
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGCTCAGTCTCAAAGATCAGGAAATCGAACAGTGGCACAAAAAGCACT[T/A]GGAGAAAATCAAGCAGAAGGAACGGGAGCGGCTAAAACAGCGTCCTGGAA
Long Flanking Sequence:
TGAGAAAACTGCTGATCATGGAAAATCTGACCGCAGTAAAGACAAAGAACGGGACAAAGATTCTGACAAGAGGAAAAAAGATAAATCAACCACTCCATCTTCCTCTTCCTACTCGAATCTAAAGTCGTTATTGGAAGAAAAGAAAGGCTATGTTTGTGAGAATAATAAGGTTGTCTCATCTAAATCAAAGGAAGAGGTAACCAAGCCTTCAGAGAAAGACCGAGATCGAAGAGAGAGGGACCGGGAGTCTGAAAGACATCGAGATCGGGAACGAGATCGGCACAAGGAAAAGGACAAAGATCGATCCCAGTTTAACAGGGATGGCAAAATTAACAAACCGAAACCAAGTGAAGTGGACTCCAAATCTAAGGTTACACCTATTCTAAAGGATACTCGTCCCAAAGAAAAGAGGCTGGTGAATGATGACCTCATGAAGACCAGCTTTGAACGCATGCTCAGTCTCAAAGATCAGGAAATCGAACAGTGGCACAAAAAGCACT[T/A]GGAGAAAATCAAGCAGAAGGAACGGGAGCGGCTAAAACAGCGTCCTGGAATTGACCCTGCGAAACAACAAAAAAACAAGGAAAAAATTAAATCATCCTCTACGTCCACTGAGCCATGTCTAACCAAGGAACTAACTCGGTCAAAGAGCTCAGAAGCGCCAGATGGACAACGTGAAAAGATCTTAAAGGACGCCACTAGTGTGAGAACTCTCTCGCTAGATGCAAAAACCTTGGGGAAGAACGGTCCTATAATTGAAAACAATCTAAGTCGATCTCCGAGACCAGAAAGTGAAAAATCTGGTCTTATGTCAAGATCAATATCAATGATCTCTGTGGCAAGTTCAGAAGACTCCTGCCAGGCAACTATTTTGACACCTAGACCAACTGACCAATATGATTCTGACATGAACGTGGAAGCCTTAGATTCGCAGCCACCTTTACTTCAGTCTTCCCTTGTTGCACAGTCCTCCAGGTCGCCTAGTGTTCATGATAAAGATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33058
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270 None None 424 None 10
ENSDART00000097864 Nonsense 1143 1987 8 12
ENSDART00000146037 None None 71 2 6
Genomic Location (Zv9):
Chromosome 2 (position 55378851)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55043851
GRCz11 2 54776790
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAAACAACAAAAAAACAAGGAAAAAATTAAATCATCCTCTACGTCCACT[G/T]AGCCATGTCTAACCAAGGAACTAACTCGGTCAAAGAGCTCAGAAGCGCCA
Long Flanking Sequence:
ACTCGAATCTAAAGTCGTTATTGGAAGAAAAGAAAGGCTATGTTTGTGAGAATAATAAGGTTGTCTCATCTAAATCAAAGGAAGAGGTAACCAAGCCTTCAGAGAAAGACCGAGATCGAAGAGAGAGGGACCGGGAGTCTGAAAGACATCGAGATCGGGAACGAGATCGGCACAAGGAAAAGGACAAAGATCGATCCCAGTTTAACAGGGATGGCAAAATTAACAAACCGAAACCAAGTGAAGTGGACTCCAAATCTAAGGTTACACCTATTCTAAAGGATACTCGTCCCAAAGAAAAGAGGCTGGTGAATGATGACCTCATGAAGACCAGCTTTGAACGCATGCTCAGTCTCAAAGATCAGGAAATCGAACAGTGGCACAAAAAGCACTTGGAGAAAATCAAGCAGAAGGAACGGGAGCGGCTAAAACAGCGTCCTGGAATTGACCCTGCGAAACAACAAAAAAACAAGGAAAAAATTAAATCATCCTCTACGTCCACT[G/T]AGCCATGTCTAACCAAGGAACTAACTCGGTCAAAGAGCTCAGAAGCGCCAGATGGACAACGTGAAAAGATCTTAAAGGACGCCACTAGTGTGAGAACTCTCTCGCTAGATGCAAAAACCTTGGGGAAGAACGGTCCTATAATTGAAAACAATCTAAGTCGATCTCCGAGACCAGAAAGTGAAAAATCTGGTCTTATGTCAAGATCAATATCAATGATCTCTGTGGCAAGTTCAGAAGACTCCTGCCAGGCAACTATTTTGACACCTAGACCAACTGACCAATATGATTCTGACATGAACGTGGAAGCCTTAGATTCGCAGCCACCTTTACTTCAGTCTTCCCTTGTTGCACAGTCCTCCAGGTCGCCTAGTGTTCATGATAAAGATATTAGCAGTCTTCCCGAATCATCGGCTCTCTGCAATCGCACACCATTGGCAAGCAGGCATGCATCACCATGCTTAAGGGCTATTCTGGATGAAGAAGCCAAGGTACCAACAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6870
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270 None None 424 None 10
ENSDART00000097864 Nonsense 1211 1987 8 12
ENSDART00000146037 None None 71 2 6
Genomic Location (Zv9):
Chromosome 2 (position 55379056)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55044056
GRCz11 2 54776995
KASP Assay ID:
554-4684.1 (used for ordering genotyping assays)
KASP Sequence:
AAGTCGATCTCCGAGACCAGARAGTGAAAAATCTGGTCTTATGTCAAGAT[C/A]AATATCAATGATCTCTGTGGCAAGTTCAGAAGACTCCTGCCAGGCAACTA
Long Flanking Sequence:
CAGGGATGGCAAAATTAACAAACCGAAACCAAGTGAAGTGGACTCCAAATCTAAGGTTACACCTATTCTAAAGGATACTCGTCCCAAAGAAAAGAGGCTGGTGAATGATGACCTCATGAAGACCAGCTTTGAACGCATGCTCAGTCTCAAAGATCAGGAAATCGAACAGTGGCACAAAAAGCACTTGGAGAAAATCAAGCAGAAGGAACGGGAGCGGCTAAAACAGCGTCCTGGAATTGACCCTGCGAAACAACAAAAAAACAAGGAAAAAATTAAATCATCCTCTACGTCCACTGAGCCATGTCTAACCAAGGAACTAACTCGGTCAAAGAGCTCAGAAGCGCCAGATGGACAACGTGAAAAGATCTTAAAGGACGCCACTAGTGTGAGAACTCTCTCGCTAGATGCAAAAACCTTGGGGAAGAACGGTCCTATAATTGAAAACAATCTAAGTCGATCTCCGAGACCAGAAAGTGAAAAATCTGGTCTTATGTCAAGAT[C/A]AATATCAATGATCTCTGTGGCAAGTTCAGAAGACTCCTGCCAGGCAACTATTTTGACACCTAGACCAACTGACCAATATGATTCTGACATGAACGTGGAAGCCTTAGATTCGCAGCCACCTTTACTTCAGTCTTCCCTTGTTGCACAGTCCTCCAGGTCGCCTAGTGTTCATGATAAAGATATTAGCAGTCTTCCCGAATCATCGGCTCTCTGCAATCGCACACCATTGGCAAGCAGGCATGCATCACCATGCTTAAGGGCTATTCTGGATGAAGAAGCCAAGGTACCAACAACTGAAACAAAACCCACAGAAGAGTCTCCGGTAATCAGTATTGCATCACAACCAACCAGCGAGCAATCTCAAGTTCATCTAACTGAGATTAGTGTCCCCCCTGTTCAGGAGACTCGGAGCAGTCAAAGTCTTACAAACTCTTTTCCAGAAAATGAAATTCTGTCTAGTAATGAAGCCGAAGTCGTCAGTTCCACATGTCAAGTACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19906
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270 None None 424 None 10
ENSDART00000097864 Nonsense 1330 1987 8 12
ENSDART00000146037 None None 71 2 6
Genomic Location (Zv9):
Chromosome 2 (position 55379412)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55044412
GRCz11 2 54777351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACAGAAGAGTCTCCGGTAATCAGTATTGCATCACAACCAACCAGCGAG[C/T]AATCTCAAGTTCATCTAACTGAGATTAGTGTCCCCCCTGTTCAGGAGACT
Long Flanking Sequence:
GTGAAAAGATCTTAAAGGACGCCACTAGTGTGAGAACTCTCTCGCTAGATGCAAAAACCTTGGGGAAGAACGGTCCTATAATTGAAAACAATCTAAGTCGATCTCCGAGACCAGAAAGTGAAAAATCTGGTCTTATGTCAAGATCAATATCAATGATCTCTGTGGCAAGTTCAGAAGACTCCTGCCAGGCAACTATTTTGACACCTAGACCAACTGACCAATATGATTCTGACATGAACGTGGAAGCCTTAGATTCGCAGCCACCTTTACTTCAGTCTTCCCTTGTTGCACAGTCCTCCAGGTCGCCTAGTGTTCATGATAAAGATATTAGCAGTCTTCCCGAATCATCGGCTCTCTGCAATCGCACACCATTGGCAAGCAGGCATGCATCACCATGCTTAAGGGCTATTCTGGATGAAGAAGCCAAGGTACCAACAACTGAAACAAAACCCACAGAAGAGTCTCCGGTAATCAGTATTGCATCACAACCAACCAGCGAG[C/T]AATCTCAAGTTCATCTAACTGAGATTAGTGTCCCCCCTGTTCAGGAGACTCGGAGCAGTCAAAGTCTTACAAACTCTTTTCCAGAAAATGAAATTCTGTCTAGTAATGAAGCCGAAGTCGTCAGTTCCACATGTCAAGTACAACCTTCGCAGGCTAGTGCTAAAGACAGTGTAACACAAGCAAACAGTGTGTTTCCGAGCCATTTGGAAGAGCAGAACAAGTTTTGCACCACTAGTAGTCAAATAGAGCATGCAAGTCTAGGTCAGCTTGATGTCCCTGGTGCAGAGGGAGTAAAAAAGGAGGCTTCACTTGCTGTTGCATCATTACAGTCATCTCATACATCAACTTCATCATCAGATTCCAATGCACATTTGCCTTCGAGTAGTCAGCATTGTGAGATTAGCTCTGCTTCCAGTGGTGAACAGACAATGACAACAGACTCTAGTTTGAGAACAGAGCAAAGAGACAAACCATTGGTTGCTTCAGAGGACAAGATTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44551
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270 None None 424 None 10
ENSDART00000097864 Essential Splice Site 1846 1987 None 12
ENSDART00000146037 Essential Splice Site None 71 None 6
Genomic Location (Zv9):
Chromosome 2 (position 55381053)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55046053
GRCz11 2 54778992
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAGAGATGGTGCGGATGAAGCTGAGACTGCAGCACAGCATCGAAAGGG[T/C]GAGTGGAAATCAAGAATGGGTGACGTTTCTTTTTTGCAATTCAGTTTTTA
Long Flanking Sequence:
GAAAACGAAAAATGCCTAGAGCTTCTCCGCTAGCCCAAGCAAATCTTACAGCTCAGCAGGTCAGAGAAAAGACACAGCAGTCCCTCGCTGCGATTGTAGATGCACTGAAGCTTGAGGAGATTCAGCCTTACCAGACAGAGAGAGCCAACCCATATTATGAGTACTTGCACATTCGCAAAAAGATCGAAGAGAAGAGGAAAGTCCTTTGTAGTGTCATTCCTCAAGCGCCTCAGTACTACGACGAGTATGTGACATTCAATGGGTCCTATCTGCTGGATGGAAACCCTCTCAGCAAACTCTGCATCCCAACAGTAAGTGATCTCCACTAACAGTATGTGAAAGTAATATTTACTCAAGAAAGACTAAGGCAAAAATGTCTCACTGTTCTTCCGTTTTGTAGATAACGCCTCCACCCTCTTTACCTGAACCACTGAAGGAGATGTTCAAACAGCAAGAGATGGTGCGGATGAAGCTGAGACTGCAGCACAGCATCGAAAGGG[T/C]GAGTGGAAATCAAGAATGGGTGACGTTTCTTTTTTGCAATTCAGTTTTTATTTTATTTTTCAAAAATAATATATAAAGTTTTACAATAACCAGAAGGATTGTTACCACTCTATATATTTTACAAACCCAGTACACATCAGGAATTACAACATAAATATAATATAGGCCAAGTAGTTCACTAACATTGACTCAATTGACATTCCTAATATTAGATAAGGGCAAGGCAGTGGCGCAGTAGGTAGTGCTGTCGCCTCACTGCAAGAAGGTCGCTGGTTCGAACCTCGGCTCCTTTGCATGGGTTTCCTCAGGGTGCTCCGGTTTCCCCCACAGTCCAAAGACATGCGGTACAGGTAAATTGGGTAGGCTAAATTGACCGTAGTGTATGAGTGGGTGTGTGAACGTGTGTGTGGATGTTTCCCAGAGATGGGTTGCGGCTGGAAGGGTATCCGCTGCGTAAAAACTTGCTGGATAAGTTGGCGGTTCATTCCGCTGTGGCAACC
Associated Phenotype:
Not determined