Busch Lab

ZMP

zgc:114058

Ensembl ID:
ENSDARG00000052379
ZFIN ID:
ZDB-GENE-050913-93
Description:
Coiled-coil domain-containing protein 22 [Source:UniProtKB/Swiss-Prot;Acc:Q4V909]
Human Orthologue:
CCDC22
Human Description:
coiled-coil domain containing 22 [Source:HGNC Symbol;Acc:28909]
Mouse Orthologue:
Ccdc22
Mouse Description:
coiled-coil domain containing 22 Gene [Source:MGI Symbol;Acc:MGI:1859608]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41195 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34393 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41195
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099769 Essential Splice Site 416 639 9 16
Genomic Location (Zv9):
Chromosome 8 (position 24482297)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23608115
GRCz11 8 23629354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACCATTGACCTTCTTCCTGACGCTGAAAACAACCTGCTCAAATTACAG[G/A]TACACAAATCATTCCACGTTCACATCTGCCATCATAAGGAAAACAGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34393
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099769 Nonsense 587 639 15 16
Genomic Location (Zv9):
Chromosome 8 (position 24487258)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23613076
GRCz11 8 23634315
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTAACTTTTTTGTGCTCCCAGAACTGCACTCAGTTGATTCAGACCATC[G/T]AGGACACAGGAACCATCATGAGAGAAATCCGAGATCTGGAGGAACAGGTG
Associated Phenotype:
Not determined