Busch Lab

ZMP

LOC100329879

Ensembl ID:
ENSDARG00000052368
Human Orthologue:
CLTB
Human Description:
clathrin, light chain B [Source:HGNC Symbol;Acc:2091]
Mouse Orthologue:
Cltb
Mouse Description:
clathrin, light polypeptide (Lcb) Gene [Source:MGI Symbol;Acc:MGI:1921575]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28362
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074208 Nonsense 148 231 5 7
Genomic Location (Zv9):
Chromosome 14 (position 47682136)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 45879334
GRCz11 14 51030566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGAAGGCCAAGAAGGAGCTGGAGGACTGGCATATACACCAGACTGAA[C/T]AGATGGAGAAGAATAAAGTCAACAACAGGTATTTTCACCACTACACCCTT
Long Flanking Sequence:
TGAGGCAAGTTGGAGCCAAACCCTGAAGGGACACCGGCCCTCCAGTACCGAGATTGGTGACCCCTGATCTAGAGTGTGTGTGCATGTGTAGTTTCAGCTCAAAATACCACACTAATAATGTTTTATCGCTCTCTGAAACTGACCCTTTTAGGCTTTGATCCTAATTGTGGTGTTTTGGCGACTGTCGCTTTAAATTCAAATTAGATTGTGCTCTTTTCAGAAGAAGGCGGAGCTACAAATGCCTGTGCATCAGCATAGTGGCAGATTCCAAAGAGTATAAAGCATTATGTGTGTGGTGTTTGAGCTGAAACTTCACATATAGGGACATCATCATCTTGTTTTACATCCTGTAAATATGTTTTACAAGCTTAAATATTAGCTTGTTTTATATATATATATATGTGTATATATGAACAGATTCAGCCTCTAAAGCTGCAGAGGCCGTGTGGAGAGAGAAGGCCAAGAAGGAGCTGGAGGACTGGCATATACACCAGACTGAA[C/T]AGATGGAGAAGAATAAAGTCAACAACAGGTATTTTCACCACTACACCCTTAAAGGGACAGTTCATCCAAACATCTAAATGTACAGGGCCTTGAAAATGCAGGTGAGTTTTTCTTCAGCACAGCATTAAAGAAGATTTTTTGGTAAATCCTGCTTCATAATGGGATTTAATAGGGACTTTTAAAAACTTCATTTGGAGCGATTGCAAATTTTAACCACGAAGATACAAAATGCATGTGTTTTTAAGGAGTGATCAGGGTTCGAATTAATCATTGGCAATCAGGGGGTCAACATTTTCGGTAGTGTTAGTTTGTGTAATACATGCTTCAGTGAATCCAATTGGGTATATGCTGAAGCATGCTAATGGGACTTTTAATTTGCCAGTAACATGGGTTAAGCGCTTCTGATGAACTGTATGCCATTGAAAAATTGTCGCGTTTAAGGTCTGTTTTCTTAAAAAATCAGCGATTTCCACTGGCTGAGTGATATCCGATATAAACTG
Associated Phenotype:
Not determined