Busch Lab

ZMP

ZXDA

Ensembl ID:
ENSDARG00000052351
Description:
zinc finger, X-linked, duplicated A [Source:HGNC Symbol;Acc:13198]
Human Orthologues:
ZNF425, ZNF786, ZXDA, ZXDB, ZXDC
Human Descriptions:
ZXD family zinc finger C [Source:HGNC Symbol;Acc:28160]
zinc finger protein 425 [Source:HGNC Symbol;Acc:20690]
zinc finger protein 786 [Source:HGNC Symbol;Acc:21806]
zinc finger, X-linked, duplicated A [Source:HGNC Symbol;Acc:13198]
zinc finger, X-linked, duplicated B [Source:HGNC Symbol;Acc:13199]
Mouse Orthologues:
Zfp786, Zxdb, Zxdc
Mouse Descriptions:
ZXD family zinc finger C Gene [Source:MGI Symbol;Acc:MGI:1933108]
zinc finger protein 786 Gene [Source:MGI Symbol;Acc:MGI:3026883]
zinc finger, X-linked, duplicated B Gene [Source:MGI Symbol;Acc:MGI:3694898]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa40690 Nonsense Mutation detected in F1 DNA Not yet available
sa26744 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40690
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058028 Nonsense 36 751 2 12
Genomic Location (Zv9):
Chromosome 6 (position 23711542)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19966988
GRCz11 6 22027210
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGTATTTGCCAAAATTTAAAACGCAAACCATTAACTTGTGAAGAATTA[C/T]AGCCAATGAACCTTTTAACTGTGTCTGGAATGACCAAGAAAGTTTCGCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5367
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058028 Nonsense 95 751 2 12
Genomic Location (Zv9):
Chromosome 6 (position 23711720)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19967166
GRCz11 6 22027388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACACAGAAGACCAGCGTCCCTTTAAATGCACAGTAGAGGGTTGTGATT[G/A]GTCTTTCACAACATCATACAAATTGAAACGCCACCTTCAGTCTCATGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3596
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058028 Nonsense 116 751 2 12
Genomic Location (Zv9):
Chromosome 6 (position 23711784)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19967230
GRCz11 6 22027452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATACAAATTGAAACGCCACCTTCAGTCTCATGACAAAGTGCGCCCTTA[T/G]AAATGTGAATGGGAAAACTGTGGTCGCCGTTTCACCACTGTCTACAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26744
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058028 Nonsense 614 751 10 12
Genomic Location (Zv9):
Chromosome 6 (position 23721855)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19977301
GRCz11 6 22037523
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCTGTTGTTCTGCCGTTAGGAAAGCAGTGGATCAGCACGCACAGATTA[C/A]AGGGCCATTCAGCTTGCCAAAAGGAGGAAGCAGAAAGGCTCAAACTCTTC
Associated Phenotype:
Not determined