Busch Lab

ZMP

ABCF2 (2 of 2)

Ensembl ID:
ENSDARG00000052331
Description:
ATP-binding cassette, sub-family F (GCN20), member 2 [Source:HGNC Symbol;Acc:71]
Human Orthologue:
ABCF2
Human Description:
ATP-binding cassette, sub-family F (GCN20), member 2 [Source:HGNC Symbol;Acc:71]
Mouse Orthologue:
Abcf2
Mouse Description:
ATP-binding cassette, sub-family F (GCN20), member 2 Gene [Source:MGI Symbol;Acc:MGI:1351657]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27018
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074155 Essential Splice Site 52 616 1 14
Genomic Location (Zv9):
Chromosome 7 (position 44148651)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41138951
GRCz11 7 41419024
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGATGACCCAGTGAATGATGCAGAAACTAATGGAGATGCGAATGGAGG[T/C]GAGTTTATTAATACAGTTCCTCAAGTTAAAGGACAATTAAGACAAGAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5438
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074155 Essential Splice Site 52 616 2 14
ENSDART00000074155 Essential Splice Site 52 616 2 14
Genomic Location (Zv9):
Chromosome 7 (position 44145981)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41136281
GRCz11 7 41416354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCAGTTYTTTCCTCYTAAATCACTCCTTTTCTATGTCACWTTTTCACTT[A/C]GATGTTGCCGCTTTGTCCAAGGAGCTGGACGAGTTTGAGATGCGTAAGAY
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27017
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074155 Essential Splice Site 52 616 2 14
ENSDART00000074155 Essential Splice Site 52 616 2 14
Genomic Location (Zv9):
Chromosome 7 (position 44145981)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41136281
GRCz11 7 41416354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGTTCTTTCCTCCTAAATCACTCCTTTTCTATGTCACATTTTCACTT[A/G]GATGTTGCCGCTTTGTCCAAGGAGCTGGACGAGTTTGAGATGCGTAAGAC
Associated Phenotype:
Not determined