Busch Lab

ZMP

si:ch211-175l6.9

Ensembl ID:
ENSDARG00000052315
ZFIN ID:
ZDB-GENE-060503-768
Description:
ubinuclein 2 [Source:RefSeq peptide;Acc:NP_001098410]
Human Orthologue:
UBN2
Human Description:
ubinuclein 2 [Source:HGNC Symbol;Acc:21931]
Mouse Orthologue:
Ubn2
Mouse Description:
ubinuclein 2 Gene [Source:MGI Symbol;Acc:MGI:2444236]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17456 Splice Site, Nonsense Available for shipment Available now
sa45131 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17456
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074147 Splice Site, Nonsense 92 1065 1 15
ENSDART00000136453 Splice Site, Nonsense 92 262 1 6
Genomic Location (Zv9):
Chromosome 3 (position 8194702)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8010900
GRCz11 3 7896740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCAGAAATCAGCRGAGTTTAACTACGGCGAGCTKATCACCKCCAGCCTG[C/T]AGGTGAGACCCTGRAACACCACTRTGSTGGGTTTAWAACCGGATTCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45131
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074147 Nonsense 118 1065 2 15
ENSDART00000136453 Nonsense 118 261 2 6
Genomic Location (Zv9):
Chromosome 3 (position 8204617)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8000985
GRCz11 3 7886825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCTCTGGACCCCAGCGATCCGTTTGCAGACGAAGACAAAGAGCGG[C/T]AGGAAGTCGAGGCTCTGGCCAGGAAGTTTGAGAGCAAATATGTATGTATC
Associated Phenotype:
Not determined