Busch Lab

ZMP

si:ch211-175l6.6

Ensembl ID:
ENSDARG00000052314
ZFIN ID:
ZDB-GENE-060503-484
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MT08]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa39995 Nonsense Mutation detected in F1 DNA Not yet available
sa33093 Nonsense Available for shipment Available now
sa15080 Nonsense Available for shipment Available now
sa17828 Essential Splice Site Available for shipment Available now
sa25241 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25994 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13253 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39995
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Nonsense 34 292 1 5
ENSDART00000133133 Nonsense 32 448 1 6
Genomic Location (Zv9):
Chromosome 3 (position 8151021)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8054581
GRCz11 3 7940421
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGAAATCTTCAAGAATCCTGTAGTTTTATCATGCAGTCACAGTGTGTG[T/A]AAAGAGTGTCTTCAACAGTACTGGAGAACCAAGACAACTCAGGAGTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33093
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Nonsense 74 292 1 5
ENSDART00000133133 Nonsense 72 448 1 6
Genomic Location (Zv9):
Chromosome 3 (position 8151140)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8054462
GRCz11 3 7940302
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAAAAGGTGAACCTCCAGTTAATCTTGCATTAAAAAACCTGTGTGAGT[T/A]GTTCCTGAAGGAGAGAAATGAGAGATGTTCATCAGCATCTGAGGAGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15080
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Nonsense 93 292 1 5
ENSDART00000133133 Nonsense 91 448 1 6
Genomic Location (Zv9):
Chromosome 3 (position 8151197)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8054405
GRCz11 3 7940245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGGAGAGAAATGAGAGATGTTCATCAGCATCTGAGGAGATCTGCAGTT[T/A]ACACAGTGAGAARCTCAAACTCTTCTGTCTGGAGGACAAACAGCCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17828
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Essential Splice Site 167 292 2 5
ENSDART00000133133 Essential Splice Site 165 448 2 6
Genomic Location (Zv9):
Chromosome 3 (position 8152476)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8053126
GRCz11 3 7938966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAATGAAGAAAKGAAAGCAGAGTTTGAGAAAACAKTTCAACACATCAAGG[T/C]GAGGAAAMATTTCAATTCAAACATTTTCATTGCAGCCGCAGGAGACACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25241
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Essential Splice Site 245 292 4 5
ENSDART00000133133 Essential Splice Site 243 448 4 6
Genomic Location (Zv9):
Chromosome 3 (position 8153001)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8052601
GRCz11 3 7938441
KASP Assay ID:
554-7321.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTGATGATGGATTGAGCTCTTGATGATCAGTTGTGTGTTTGTTCTGC[A/T]GGAGTTTCCAGTCTCGATGGAAAGGTGAGTGATCTGCTGGTGTCTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25994
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Essential Splice Site 252 292 4 5
ENSDART00000133133 Essential Splice Site 250 448 4 6
Genomic Location (Zv9):
Chromosome 3 (position 8153026)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8052576
GRCz11 3 7938416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATCAGTTGTGTGTTTGTTCTGCAGGAGTTTCCAGTCTCGATGGAAAG[G/T]TGAGTGATCTGCTGGTGTCTCTGCTCTCTCTGCTTCTGAATCCTGCAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25995
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 None None 292 None 5
ENSDART00000133133 Essential Splice Site 290 448 6 6
Genomic Location (Zv9):
Chromosome 3 (position 8170755)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8034847
GRCz11 3 7920687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATAAGAATAAATAATATAATCAAATGTATTATGTGATTTTGTCTCTTC[A/G]GCTCCTGTAATTCTGGATCCAAACACTGCTCATCCAGGTCTAATCCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13253
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 None None 292 None 5
ENSDART00000133133 Nonsense 352 448 6 6
Genomic Location (Zv9):
Chromosome 3 (position 8170942)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8034660
GRCz11 3 7920500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGWTCAGAGGGTTTCATCTCAGGGAAACACTGCTGGGATGTGGAGGTC[A/T]AAGAAAGTTTATACTGGAAYTTTGGAGTAWCTACAGCATCAAACCAGAGG
Associated Phenotype:
Not determined