Busch Lab

ZMP

LOC100332594

Ensembl ID:
ENSDARG00000052254
Human Orthologue:
ZNF644
Human Description:
zinc finger protein 644 [Source:HGNC Symbol;Acc:29222]
Mouse Orthologue:
Zfp644
Mouse Description:
zinc finger protein 644 Gene [Source:MGI Symbol;Acc:MGI:1277212]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa14999 Nonsense Available for shipment Available now
sa7038 Nonsense Mutation detected in F1 DNA Not yet available
sa15981 Nonsense Available for shipment Available now
sa6068 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14999
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Nonsense 242 1267 2 6
Genomic Location (Zv9):
Chromosome 6 (position 20893643)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24581537
GRCz11 6 24681346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTGATGGWCTGAACTGGGGCCTGCAGGAGAAGTTCATGCGGATACTGT[T/A]GAACAGCAGCGTAGCAGGTGATGGGGTAAGAACAAAGGTGGAGATTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7038
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Nonsense 348 1267 2 6
Genomic Location (Zv9):
Chromosome 6 (position 20893960)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24581854
GRCz11 6 24681663
KASP Assay ID:
554-5417.1 (used for ordering genotyping assays)
KASP Sequence:
TCTGCGACAAGTCAGCTGCCATGAAGGAGCTAATTTCAAGCGAGAAGGAA[G/T]AGAGATGTGATGAAGGCGGCAGCGACRTAGAAACAAACACCTACATGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15981
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Nonsense 585 1267 2 6
Genomic Location (Zv9):
Chromosome 6 (position 20894671)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24582565
GRCz11 6 24682374
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGATGATCAACCCAAAACCAAGGACTTATCCTTGCCTATGCCAAAGATK[C/T]AAAGCACAGAGAAATGGTCAGTTAAGGACAGAGGTGAGCTGCCCTTTAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5360
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Nonsense 819 1267 2 6
Genomic Location (Zv9):
Chromosome 6 (position 20895373)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24583267
GRCz11 6 24683076
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATCCCTTTCAACAACAACATTCCTGACTATGCCAGTCATTCTAATCCA[G/T]AAGATAGCATAGAAGAGGACAGCGATGAGATTCGTACATTTATAATAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8229
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Nonsense 976 1267 3 6
Genomic Location (Zv9):
Chromosome 6 (position 20895997)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24583891
GRCz11 6 24683700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCTCCAATCATGTGCGGGGCCACCTGAAGCGGATTGGCAAGCCTATTT[C/A]GGGTGCTAGCAAGTCACCTCTCWGCATTCWGTCTGAACTTCTTCAGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6068
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Essential Splice Site 1119 1267 3 6
Genomic Location (Zv9):
Chromosome 6 (position 20896429)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24584323
GRCz11 6 24684132
KASP Assay ID:
554-3875.1 (used for ordering genotyping assays)
KASP Sequence:
MGGCATACCCAGAACACCATCTGTGAAGCTTGATCCTACCTGGAGCCAAG[G/A]TTAGGAACCATACATTCACTCATTGATTTGTCATTAGCCAGAAAATGAAT
Associated Phenotype:
Not determined