Busch Lab

ZMP

AFF2

Ensembl ID:
ENSDARG00000052242
Description:
AF4/FMR2 family, member 2 [Source:HGNC Symbol;Acc:3776]
Human Orthologue:
AFF2
Human Description:
AF4/FMR2 family, member 2 [Source:HGNC Symbol;Acc:3776]
Mouse Orthologue:
Aff2
Mouse Description:
AF4/FMR2 family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1202294]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa42382 Nonsense Mutation detected in F1 DNA Not yet available
sa17308 Essential Splice Site Available for shipment Available now
sa2742 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28292
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Nonsense 490 1269 10 21
Genomic Location (Zv9):
Chromosome 14 (position 21693139)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20394627
GRCz11 14 20691872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTCTGAGTCTGATTCAGACAGCGAGAGCAGCTCTAGTGACAGTGAGTG[C/A]AACAGAGCGTCTCGCGCCGCCACACCAGAGGTACTGACCGCTTACTCTCA
Long Flanking Sequence:
AAAAAATGACTTTTGCTGCATTTTTAAACTACCGGGTCGGCCATTTATATAGATACACCTTAATAAAATGGAAAGGGTTGGTGATATTAACGTCCTGTTTGTGGCACATTAGTATATGTGAGGGGGCAAACTTTTCAAGAAGGGTGGTGACCATGGTTGCCATTTTGGATCCAACTTTTGTTTTTGTTTTTCAATAGGAAGAGAGTTGTATTAAACTGTAAAGTAGTAAACTGTGTAAGTGGTTGATAATATTAAGCAAGCATTAATAAAACAACCTGAACTGTATCTGTGCTGTCAATGGTGCACTTGTATGGATTGATGTGTGTTATATCCATTGATGAATGTTCTTTTTCTTTTGTCTACAGTCTTCCTGGAAGCACAGCAGTACGGAGCAGCGAAGCGGCCGGCCACTCCAGCGGAGCGTCTGGAAGCTCCAGTGAATCTGAGAGCAGTTCTGAGTCTGATTCAGACAGCGAGAGCAGCTCTAGTGACAGTGAGTG[C/A]AACAGAGCGTCTCGCGCCGCCACACCAGAGGTACTGACCGCTTACTCTCACTATATACCCAGTCATTCAGCCATCACTTATTTCTAGAAAGCTGTTTTTAATCAGTCTGCCTAGTGCACCAGTGGTGAAAGAGTTTTGATATGCTCATTTGACCATTTGTTTTTGGGTTTGTGTGTGACAGATGGTGACATATATTTACTGTAGGTGTTTTATTATAAGAAAATACTGATGTAAATGTTGTGTTTGGTAGCATTGGTGGTATTTTTATTATACAGAAGCCTATTTCAGCCATATGGTAAAAAAAAAAAAAAAAACTATTTTTTTCATAACTTTATATTTGTTTAAATCTTTTGTATTTAGTATTTTTTAAATTTTATAGACTTTTTCAAAAAATCTGACTTTTGCTCTGGGGTGCATTTTCTGAAAACCATCGTTGGCCAACTGAGGTCGCAAGTTGCATCGTTAAAAACATAGTTTGTTGATTTGGCGTTTCCCAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42382
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Nonsense 526 1269 11 21
Genomic Location (Zv9):
Chromosome 14 (position 21695779)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20397267
GRCz11 14 20694512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAGTGGATTAAAAAAGTGAATCCTCACAATAAAGCACTAATTAACACC[C/T]AGGCAGATAGTCATGGGCTTAACAGTTCTCAACCTGATGAAAGCCAAACC
Long Flanking Sequence:
GGAAAGATTTACTTCTGTCTGGAAACATAATGGAACACAACAATTGGCGTGAGATAATATCGCTGATGAAAACATCACCGCAGTGAGAGCTGTGAGCAGTCATCAGGACAGTACTCACAGCATTTTCTCTGTTATTCACCAGTTTTATGACTTCCTCTGTTAATGGCCTTTTCATCATAGCATCAACTCGTTGGTCTGTGAAAGTCATATGACTAAATCATCGAGCTTCCTGTGAATCAGTGCTGATGACGTATGAAAGCTGTACAGATACGCATCATTAGAAATTCAGCTTCCTTGTTATTAAATTCATTTATATTGTACAGGAGTCGACATAAAATAATGTTGTATTCAATTTCCTTCCTATTTTGTAATTCAAATAGTAGTTAGTATACCTAAGACTATGTTTTGTTTTGTTTTTCCACCAGCCTGAACCAAGCAAGTGGCAACTAGATAAGTGGATTAAAAAAGTGAATCCTCACAATAAAGCACTAATTAACACC[C/T]AGGCAGATAGTCATGGGCTTAACAGTTCTCAACCTGATGAAAGCCAAACCTCTGAGAACCAGAGCTACAGCAAGAGCAAGCCCAGCACAGCCCTGGCACCAGCAGACCCCAAGGAGAGAACGTTGCTAAGTCCCATCCGAGAGAAAGCCAAACCCAAGGCTGGTCAGAAGGCTCCAGACAGCAAAAGCACCAAGGTGAAATCACCAGCCTCAGTGGAGCTCGCACCTCCCAGGAGAAGCACTGGAAAGAAGCAGCCCAAAAAGGTGGAGAGATCTTCCAGCAGTGAGGAGCACAACTGGCCAAGACCAGGAAACTCAAGTTCTACCCCAAAAGAGAAAGAGCCGCCGCCTTTAGAACCACCAAAACCTAGAGGCAAGGGCCCTGTGGTCAAGACTGCTCCAAGAAAGGAACCTCGGACCACCACAACAAGCACTGCACCAACTAACATCGCACCAGTTCCAGATAAAAAGAAGCACCGTGGACCCAATAAGATAATTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17308
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Essential Splice Site 846 1269 11 21
Genomic Location (Zv9):
Chromosome 14 (position 21696743)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20398231
GRCz11 14 20695476
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTATCCCTRCAGAAAAGAACCCAAGCAAATCRAAGAGGAAACACAAGG[C/A]AAGTCTKAAATGTTGTTGCTCTCGCCTCRTACACTCTATAATTATCAAAT
Long Flanking Sequence:
TAAAAAGAAGCACCGTGGACCCAATAAGATAATTCCCAAGTCTAAGGAATTCATAGAGACTGAGTCTTCTTCATCAGAGTGTCATTCGGACCCCGAGGAGCTCACTAAGGTTCAGCTTCCCTGTCCGGGTCCCAACACCCTAAGCCTGAAATCCAAGGATTGCAACAGCAATATCCTGAGTGTTAGTAGCCTTACCAGCACAAGCAGTACCTCCATTCCTGACCCAGGTGCCTCAGATCTCCTGGAAGAACACCTTTTTTCTCCTATCCCCATTGTACAAAATGAACTTTTGTCACCGCTGAGAGATTTTGAGGACATCAAGTCCCTTTGGGTTAAGATTGAACTCAGCTTCCTGTCGCGGATCCCAGGGCAAGACCCCCCAGAGCCTCCCCCAACCAAGGCTGAGTGCCGGGAGGTCAGCGTCAAGCACAGAAGGCAACAGTCGCCTGCCTCTATCCCTGCAGAAAAGAACCCAAGCAAATCGAAGAGGAAACACAAGG[C/A]AAGTCTTAAATGTTGTTGCTCTCGCCTCGTACACTCTATAATTATCAAATCAAGGGCAGCAATAGAAAAATAATCATGTAATTATTATTTTACAAGTAGTTATTTAGCAGATCCTTGTAGCAACATGCACTTCATTTAGGTAATGTTGAGTTATTATGCCAGAGTTTTGAATAAATAATGACTTCAGTTCAGTCTATAAAGCACACAAAGATATTGTTTGGTATTGTTTATTTGTTACCTAAATGCAAAGTGAATTCTTGCTGAATTTGGTGAGGTTTTTTTCAAATAAATTCATAGAAATATTAATAATAACCATTCAGCACTCAACATATGAGAAAATTGTACAACAAAAGTTAGTGGATACATATTTTCAAAGATTAAGAACTATCTAATGTTTTTTTTTTAGACTGGATGAAGAATCCTTGGATGCTAATAAATAGTTAGTTGCAGGTAGACATAGATTAAACTGTAAAATACTCTTTTCTATTTCCAGAAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2742
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Nonsense 1032 1269 15 21
Genomic Location (Zv9):
Chromosome 14 (position 21707665)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20409153
GRCz11 14 20706398
KASP Assay ID:
554-2703.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTTACAGTGTTCACAGTGCAGATTACTACATGCAAGAAGCCAAGAAGT[T/A]GAAGCACAAGGCTGATGCTTTGGTAAGTCTGGCTAATATGTTGATGTGCA
Long Flanking Sequence:
CCACGTGGCGATCGTCTAAAATCAATCCAGCTAAATGGCCCTAAAAATGAAAACACTGAGTAGATGCAGAATAGGGGGAAAGTGAATGGATCCTTAATGTATTATTCAAGCTTTTAAAGGCTAATTATCATTTTAATGTTCTCTTGCTTTTCCAGGAGGAAGACAGTCACAGCAAGCCATCGGGTGGTTTTCACGGCAATGGTCAGTCAGAAGCAGACCTCTGGTCAAACCCTTCAGCTCTGACAATGGAGCACATGGAGCCCCGGAGACCTAAACTCACATTTAATAGCACGTACGTAACAGCCATGTGATTATTGAGAGTAATAACTGGCTGATGTACTTAAGACTGATTGAATCAGAGGTGTTGTAGTTCTGCATACTTCAGGTTCATGTTTATGCACACAGTGAAATGTATATGGAAAAAAATCAAACATACTTTAATCACACTTATCTTTACAGTGTTCACAGTGCAGATTACTACATGCAAGAAGCCAAGAAGT[T/A]GAAGCACAAGGCTGATGCTTTGGTAAGTCTGGCTAATATGTTGATGTGCACAATGCAATATTTGCTATATGTTTACATGTGATTGTAACTAAAACCAAAACTTGAATTAAAGCATTACTTATTGTTTCTTAAAATAAAACATTTTAATTATCATCATATTTAATTAGGCTTGGACAAAAAGTGTTTGCATTGTGAGTCTGTATCGACGAATGATTCTGCATCAAGTTTGAAATTGTCTGAATGCACTGTGTTTTTTTTTGCAATCGACTCAGACCTTAGTTTTAACACTAGATGACACTGTAATTTTTCATTTATTTTTTTACATTTAGGCACTCTTATTCCTTACACATACCCCTTGAAAGTAAAACAATCATTAATAAAGATGTTGTTTCAATGAAAAGGGATTTACAGAGTGTTCATGATGAGTTGGGCTTATGATAATCTTGTGGAATTAAAGCTGCGATGTAAGGATATCTGACCACTTACAGTACCGAAAGTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28293
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Essential Splice Site 1039 1269 15 21
Genomic Location (Zv9):
Chromosome 14 (position 21707689)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20409177
GRCz11 14 20706422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACTACATGCAAGAAGCCAAGAAGTTGAAGCACAAGGCTGATGCTTTGG[T/C]AAGTCTGGCTAATATGTTGATGTGCACAATGCAATATTTGCTATATGTTT
Long Flanking Sequence:
ATCCAGCTAAATGGCCCTAAAAATGAAAACACTGAGTAGATGCAGAATAGGGGGAAAGTGAATGGATCCTTAATGTATTATTCAAGCTTTTAAAGGCTAATTATCATTTTAATGTTCTCTTGCTTTTCCAGGAGGAAGACAGTCACAGCAAGCCATCGGGTGGTTTTCACGGCAATGGTCAGTCAGAAGCAGACCTCTGGTCAAACCCTTCAGCTCTGACAATGGAGCACATGGAGCCCCGGAGACCTAAACTCACATTTAATAGCACGTACGTAACAGCCATGTGATTATTGAGAGTAATAACTGGCTGATGTACTTAAGACTGATTGAATCAGAGGTGTTGTAGTTCTGCATACTTCAGGTTCATGTTTATGCACACAGTGAAATGTATATGGAAAAAAATCAAACATACTTTAATCACACTTATCTTTACAGTGTTCACAGTGCAGATTACTACATGCAAGAAGCCAAGAAGTTGAAGCACAAGGCTGATGCTTTGG[T/C]AAGTCTGGCTAATATGTTGATGTGCACAATGCAATATTTGCTATATGTTTACATGTGATTGTAACTAAAACCAAAACTTGAATTAAAGCATTACTTATTGTTTCTTAAAATAAAACATTTTAATTATCATCATATTTAATTAGGCTTGGACAAAAAGTGTTTGCATTGTGAGTCTGTATCGACGAATGATTCTGCATCAAGTTTGAAATTGTCTGAATGCACTGTGTTTTTTTTTGCAATCGACTCAGACCTTAGTTTTAACACTAGATGACACTGTAATTTTTCATTTATTTTTTTACATTTAGGCACTCTTATTCCTTACACATACCCCTTGAAAGTAAAACAATCATTAATAAAGATGTTGTTTCAATGAAAAGGGATTTACAGAGTGTTCATGATGAGTTGGGCTTATGATAATCTTGTGGAATTAAAGCTGCGATGTAAGGATATCTGACCACTTACAGTACCGAAAGTACAAGCACTCTTATTTGTGTTCAGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28294
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Nonsense 1112 1269 18 21
Genomic Location (Zv9):
Chromosome 14 (position 21716504)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20417992
GRCz11 14 20715237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATGCATAATCTTAATAATGTGTATTTTCTCTTTTTCAGCAATCGTTG[T/A]TTGTCACTTTTGTACTTGCGAATGTTCAAGCTGAAGAAAGATCATGCGAT
Long Flanking Sequence:
ATATATATATATATATATATATATATATATATATACACTTATTTGTGGATGTTTGTATTTTCATTGTAGTTGTCTTTTATTTCTTTAATTCTACTTTCCAAAATGAATCCTCATTGCACTTAACAAGTTTACAATGATAATAAAGTGATTAATGAAGAAACAATAAAGCTTTGTTTCATTGTTTATCTTCATTTACAAGTAGCAGAGTATTTAGCGCTACTGTAGGCTATTCCTTACAGTTTGCATCCCGTCCCTTTGTGCCCCCTTGTTTTTTTTTACCTAAAAAACACATTCTTACTCCGCCTCTCTGGTGGTGGTACAAGGCGCGCTGGTATTGGTAATTTTAAAGTGTCACCTACTGTAACAAAAAATAATAAAAATCAATAGCTGAGACATAAGAGTCCTCTGCATTATCTATATATACATAAACACACAAATGCCCTTCAATACATTATGCATAATCTTAATAATGTGTATTTTCTCTTTTTCAGCAATCGTTG[T/A]TTGTCACTTTTGTACTTGCGAATGTTCAAGCTGAAGAAAGATCATGCGATGAAGTATTCCCGCTCACTAATGGAGTATTTCAAGGTAAGACTTTTGTTTACTGAAAATGTGAAATAGATCTTCAAATTAACTTCATATTTGTATGAATGGCATGATCTCCTTATGATATTTCATATTATTATTACAGACATTTGATGTTAACCAATTAGGATTAAAAGCATTATTACATTTCTTAGCTTGTTAGCTTGTGCATAATTAGTTCATGTTAGTAAATACACTGTGCATCACTGTGGCGCAATGGGTAGAGCTGTTGCCACACAGCAAGAAGATCACTGGGTCCATTGGCTTTTCTATGTGGAGTTACCATGTCCTCCCTGTGTTCATGTGGGTTTTCCCCCCAAAAAAGTCCAAAGACATGCTATAAGTGAATTGAGTAAGCTAAATTGACCGTAGTGTACTGTACATGTATGTGTGTAACTTTGATATAAATGGCCCTAGGG
Associated Phenotype:
Not determined