Busch Lab

ZMP

c3c

Ensembl ID:
ENSDARG00000052207
ZFIN ID:
ZDB-GENE-990415-37
Description:
complement component c3c [Source:RefSeq peptide;Acc:NP_001032313]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12504 Essential Splice Site Available for shipment Available now
sa32793 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9572 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12504
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052683 Essential Splice Site 198 1651 5 41
Genomic Location (Zv9):
Chromosome 1 (position 56826350)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55610283
GRCz11 1 56279579
KASP Assay ID:
2259-1285.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGAAAAAGGTGTGAARTCTTCRATCTACAACATCCCTGAGGTTACTAG[G/A]TGTGTAAATCACTGTTGGGACTAATACGATTCAMCTAGRGTTAACTGGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25702
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052683 Essential Splice Site 743 1651 18 41
Genomic Location (Zv9):
Chromosome 1 (position 56840674)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55624607
GRCz11 1 56293903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAATCTAATCTACTGTGTGCCTTTAGTATATTCTGACATTTATCATTAC[A/T]GAAGATGATGAAGAGACTTATGAAGAGGATTATGAAGACTATGATGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32793
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052683 Essential Splice Site 857 1651 20 41
Genomic Location (Zv9):
Chromosome 1 (position 56841268)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55625201
GRCz11 1 56294497
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAAATCAAGGCCATTATTCACAACTACACCCCCAAACACCTGAAGAAG[G/A]TAGGTTTGACAGTTGGGTAGGCTGGCTTTCAGAATGTATTAATTATTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9572
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052683 Nonsense 1034 1651 24 41
Genomic Location (Zv9):
Chromosome 1 (position 56850149)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55634082
GRCz11 1 56303378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTATCTGGACAACACCAATCAGTGGGAATCTGTTGGCATTGACCGCCGT[A/T]AAGTTGCCATTAACCATATCAAAACAGGTCAGGATACAACAGATNNNNNN
Associated Phenotype:
Not determined