Busch Lab

ZMP

si:ch211-236k19.8

Ensembl ID:
ENSDARG00000052154
ZFIN ID:
ZDB-GENE-060526-123
Description:
Novel protein similar to vertebrate Lix1 homolog (Mouse) like (LIX1L) [Source:UniProtKB/TrEMBL;Acc:A
Human Orthologue:
LIX1
Human Description:
Lix1 homolog (chicken) [Source:HGNC Symbol;Acc:18581]
Mouse Orthologue:
Lix1
Mouse Description:
limb expression 1 homolog (chicken) Gene [Source:MGI Symbol;Acc:MGI:1913893]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa17265 Nonsense Available for shipment Available now
sa38523 Nonsense Mutation detected in F1 DNA Not yet available
sa17184 Nonsense Available for shipment Available now
sa10387 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17265
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073951 Nonsense 29 255 1 5
ENSDART00000140305 Nonsense 29 128 1 3
ENSDART00000144816 Nonsense 43 290 2 6
Genomic Location (Zv9):
Chromosome 5 (position 68401001)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64142501
GRCz11 5 64823665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAAACAAGCAGCAGRCGTGATGATGGAGATRGAGAATCTGGTAGTGTA[T/G]GAGTCCATTCCTTCACCCAGTCCTCCATTCATATRCTACGTCACATTACC
Long Flanking Sequence:
AGCAGCAGCTATGTGATGTCAATATAAACCAAAATCTCTGAAAATAGTTTTTAGCACCTTGTTGAATCCTTTCCTCAATAAATTAAAGCTATATTAAAGGCAAACAGGATATTAGCAAGGTTGACCAAATAAAGTGGCTGACGAGTATGTATTTAAAAGCATAGTTCACCCACAATATTTACTTCTTTTTTTCTCAGCCTAAAGTGGTTCCAAACCTTCATGAGTTTCTTTACTCTGTTGAAGACCAAAGAAGCTAAAAACCTGTAACCATTGACTTCCATAGTAGACCATAAAAATAAATAAATACTATTGGTTACAGGTTTCCAGCATTCAAACAGGTTTGGAACAAGGGTTAGTAAATGATGCAGGATTTTCAGTGAACTAGCCCTTTAATATGATCTTTTCTTGCTTCTAGTGAATGTCGTGGGAATGCTTCACAAGTTCTGGGAGCAGAAACAAGCAGCAGGCGTGATGATGGAGATAGAGAATCTGGTAGTGTA[T/G]GAGTCCATTCCTTCACCCAGTCCTCCATTCATATGCTACGTCACATTACCAGGTGGCAGCTGCTTCGGCAATTTCAAGGTAAGTGAACTGAATTAAAAGTGCCGTTATACTTTTATTTGTCATATTATATGAGATACATTTACACACTCTTTTTAATTTTTCAGAAGGTAGCTTTTCAGACTTTTTTCTTACATTGAAGTAGGTGTTTAGCTAAAACCACACTGAAATAAATTATTCAAAGATGATTCCTTGAATTTACTAAAATATTTTAAGTTAAGTGGTTGTAAAAAATTTGTAAATCGTAATACCCTCGATCTCGGGGCTCCCTCCCGTAAGAAGGGCGAGAGGGGAGTTCGAGCTCAGGTAGGTCTCAAGAACTCCCCTGCTGTCGTTTGAGAAGTGTAAACTTGGTTGATAATTTGGTTTTGGCTATGTTGTATGTTTTTGGACAGCGGGAGGAAACCCATGACCACACGGTGAGAGCTGAAACTCCGCACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38523
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073951 Nonsense 185 255 5 5
ENSDART00000140305 None None 128 None 3
ENSDART00000144816 Nonsense 199 290 6 6
Genomic Location (Zv9):
Chromosome 5 (position 68392096)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64133596
GRCz11 5 64814760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCGTCTGGACGAGCGCACGCGCAGCCACATGGCACTGGACTGGTTA[C/T]AGAAGGAGCTTCAGTCACCCGGCCTGCTGTCCCAGGAGCTGCAGCTGGCT
Long Flanking Sequence:
CTGGCCTCCGCTACATGTGCGTTACACTTATTAATACAATGACTATGTTTACTATGTTTTGAGAGCTGAGGTGTGAGCTGAGCTATGGTGTGAGGGCTTTGCAATCAAAATATGTTATTATAATGGAAGTCAATGGGGCAAAACATGTATTTTCTCAAAACATGTATCAAAATAAGATTTGCAACCAACAATCATTCTGTTTTAGAAAGCTCTAGACAAATTAAGCCTCAAAATCACCCCAGAGTGGATGAAAGCATCCCCAACAGCACAGAAGGGTTAACTATTGTTTACTTCTTTTCTGTGGCCAAGTGTTTGTTTTGATTTTCCTAATTTAGAAAATATATATAAAAAAACATAACTTATTGGTTGAATCAAGCCTCCTGCTTCATTGAAAGAACTCTCACACATGTTGTAACGGCGTTTCCCAGGAAGTGATCCAGTACTACTCTCAGCAGCGTCTGGACGAGCGCACGCGCAGCCACATGGCACTGGACTGGTTA[C/T]AGAAGGAGCTTCAGTCACCCGGCCTGCTGTCCCAGGAGCTGCAGCTGGCTGTGAAGGAGCTCGGGGAGGCACGGAGAACCGGCAGGGAGCTCCGCTTCTACAAGGAGAAGAAAGAAATCCTCAGTTTAGCTCTCAGTCATGCTGACGCCGAGGACCTGGAGGAGGAAATGTCCTGGAGAGAAGCAACTGAGTTTGACTGTTTTGAGGAAAGGAGGACCGATACGAATGAAAGCTGTCAGTTTCACTCTCAGGGCAGTGATGGAGAATCGCTGGAGTGAAATTTGTGAGAAGTTATGTATATAATGTACATGCTGCACTTTTTCAAAATAGGCCTGCTTTTGATAAGTATTTCCTATGGTGTGAGTATAACTTTTTAGGACTCTTATTTTGTAATGTGCGCCATGCAGAAGTGCGCTCGTTTTTGCAACTGTTTTAAAAACTTCCGATTCAGTTTGCCTACGGGAGAAATGGCAGAAAATGACCAAACTACTTGCTCTGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5337
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305 None None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305 None None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305 None None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
Genomic Location (Zv9):
Chromosome 5 (position 68391946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64133446
GRCz11 5 64814610
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAGGAGAAGAAAGAAATCCTCAGTTTAGCTCTCAGTCATGCTGACGCC[G/T]AGGACCTGGAGGAGGAAATGTCCTGGAGAGAAGCAACTGAGTTTGACTGT
Long Flanking Sequence:
TTTCTCAAAACATGTATCAAAATAAGATTTGCAACCAACAATCATTCTGTTTTAGAAAGCTCTAGACAAATTAAGCCTCAAAATCACCCCAGAGTGGATGAAAGCATCCCCAACAGCACAGAAGGGTTAACTATTGTTTACTTCTTTTCTGTGGCCAAGTGTTTGTTTTGATTTTCCTAATTTAGAAAATATATATAAAAAAACATAACTTATTGGTTGAATCAAGCCTCCTGCTTCATTGAAAGAACTCTCACACATGTTGTAACGGCGTTTCCCAGGAAGTGATCCAGTACTACTCTCAGCAGCGTCTGGACGAGCGCACGCGCAGCCACATGGCACTGGACTGGTTACAGAAGGAGCTTCAGTCACCCGGCCTGCTGTCCCAGGAGCTGCAGCTGGCTGTGAAGGAGCTCGGGGAGGCACGGAGAACCGGCAGGGAGCTCCGCTTCTACAAGGAGAAGAAAGAAATCCTCAGTTTAGCTCTCAGTCATGCTGACGCC[G/T]AGGACCTGGAGGAGGAAATGTCCTGGAGAGAAGCAACTGAGTTTGACTGTTTTGAGGAAAGGAGGACCGATACGAATGAAAGCTGTCAGTTTCACTCTCAGGGCAGTGATGGAGAATCGCTGGAGTGAAATTTGTGAGAAGTTATGTATATAATGTACATGCTGCACTTTTTCAAAATAGGCCTGCTTTTGATAAGTATTTCCTATGGTGTGAGTATAACTTTTTAGGACTCTTATTTTGTAATGTGCGCCATGCAGAAGTGCGCTCGTTTTTGCAACTGTTTTAAAAACTTCCGATTCAGTTTGCCTACGGGAGAAATGGCAGAAAATGACCAAACTACTTGCTCTGCAAACAAGTGTGTTCATGACTGTACATAAAAAGTAGAATAACCCATTAAGGAAAACATTTGCAACATGACCCTGCTGAAAAATCCAGCTTAAACCAGCCTAAGCTGGTTGGCTGGTATTAGCTGGTTGACTAGAGGGGTTTTGGCCATTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17184
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305 None None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305 None None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305 None None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
Genomic Location (Zv9):
Chromosome 5 (position 68391946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64133446
GRCz11 5 64814610
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAGGAGAAGAAAGAAATCCTCAGTTTAGCTCTCAGTCATGCTGACGCC[G/T]AGGACCTGGAGGAGGAAATRTCCTGGAGAGAAGCWACTGAGTTWGACTGT
Long Flanking Sequence:
TTTCTCAAAACATGTATCAAAATAAGATTTGCAACCAACAATCATTCTGTTTTAGAAAGCTCTAGACAAATTAAGCCTCAAAATCACCCCAGAGTGGATGAAAGCATCCCCAACAGCACAGAAGGGTTAACTATTGTTTACTTCTTTTCTGTGGCCAAGTGTTTGTTTTGATTTTCCTAATTTAGAAAATATATATAAAAAAACATAACTTATTGGTTGAATCAAGCCTCCTGCTTCATTGAAAGAACTCTCACACATGTTGTAACGGCGTTTCCCAGGAAGTGATCCAGTACTACTCTCAGCAGCGTCTGGACGAGCGCACGCGCAGCCACATGGCACTGGACTGGTTACAGAAGGAGCTTCAGTCACCCGGCCTGCTGTCCCAGGAGCTGCAGCTGGCTGTGAAGGAGCTCGGGGAGGCACGGAGAACCGGCAGGGAGCTCCGCTTCTACAAGGAGAAGAAAGAAATCCTCAGTTTAGCTCTCAGTCATGCTGACGCC[G/T]AGGACCTGGAGGAGGAAATGTCCTGGAGAGAAGCAACTGAGTTTGACTGTTTTGAGGAAAGGAGGACCGATACGAATGAAAGCTGTCAGTTTCACTCTCAGGGCAGTGATGGAGAATCGCTGGAGTGAAATTTGTGAGAAGTTATGTATATAATGTACATGCTGCACTTTTTCAAAATAGGCCTGCTTTTGATAAGTATTTCCTATGGTGTGAGTATAACTTTTTAGGACTCTTATTTTGTAATGTGCGCCATGCAGAAGTGCGCTCGTTTTTGCAACTGTTTTAAAAACTTCCGATTCAGTTTGCCTACGGGAGAAATGGCAGAAAATGACCAAACTACTTGCTCTGCAAACAAGTGTGTTCATGACTGTACATAAAAAGTAGAATAACCCATTAAGGAAAACATTTGCAACATGACCCTGCTGAAAAATCCAGCTTAAACCAGCCTAAGCTGGTTGGCTGGTATTAGCTGGTTGACTAGAGGGGTTTTGGCCATTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10387
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305 None None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305 None None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305 None None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
Genomic Location (Zv9):
Chromosome 5 (position 68391946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64133446
GRCz11 5 64814610
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAGGAGAAGAAAGAAATCCTCAGTTTAGCTCTCAGTCATGCTGACGCC[G/T]AGGACCTGGAGGAGGAAATGTCCTGGAGAGAAGCWACTGAGTTTGACTGT
Long Flanking Sequence:
TTTCTCAAAACATGTATCAAAATAAGATTTGCAACCAACAATCATTCTGTTTTAGAAAGCTCTAGACAAATTAAGCCTCAAAATCACCCCAGAGTGGATGAAAGCATCCCCAACAGCACAGAAGGGTTAACTATTGTTTACTTCTTTTCTGTGGCCAAGTGTTTGTTTTGATTTTCCTAATTTAGAAAATATATATAAAAAAACATAACTTATTGGTTGAATCAAGCCTCCTGCTTCATTGAAAGAACTCTCACACATGTTGTAACGGCGTTTCCCAGGAAGTGATCCAGTACTACTCTCAGCAGCGTCTGGACGAGCGCACGCGCAGCCACATGGCACTGGACTGGTTACAGAAGGAGCTTCAGTCACCCGGCCTGCTGTCCCAGGAGCTGCAGCTGGCTGTGAAGGAGCTCGGGGAGGCACGGAGAACCGGCAGGGAGCTCCGCTTCTACAAGGAGAAGAAAGAAATCCTCAGTTTAGCTCTCAGTCATGCTGACGCC[G/T]AGGACCTGGAGGAGGAAATGTCCTGGAGAGAAGCAACTGAGTTTGACTGTTTTGAGGAAAGGAGGACCGATACGAATGAAAGCTGTCAGTTTCACTCTCAGGGCAGTGATGGAGAATCGCTGGAGTGAAATTTGTGAGAAGTTATGTATATAATGTACATGCTGCACTTTTTCAAAATAGGCCTGCTTTTGATAAGTATTTCCTATGGTGTGAGTATAACTTTTTAGGACTCTTATTTTGTAATGTGCGCCATGCAGAAGTGCGCTCGTTTTTGCAACTGTTTTAAAAACTTCCGATTCAGTTTGCCTACGGGAGAAATGGCAGAAAATGACCAAACTACTTGCTCTGCAAACAAGTGTGTTCATGACTGTACATAAAAAGTAGAATAACCCATTAAGGAAAACATTTGCAACATGACCCTGCTGAAAAATCCAGCTTAAACCAGCCTAAGCTGGTTGGCTGGTATTAGCTGGTTGACTAGAGGGGTTTTGGCCATTTCC
Associated Phenotype:
Not determined