Busch Lab

ZMP

slc1a2a

Ensembl ID:
ENSDARG00000052138
ZFIN ID:
ZDB-GENE-100422-11
Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 2a [Source:RefSeq pepti
Human Orthologue:
SLC1A2
Human Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 2 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Slc1a2
Mouse Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 2 Gene [Source:MGI Symbo

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa34174 Nonsense Mutation detected in F1 DNA Not yet available
sa30892 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41004 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa729 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34174
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073932 Nonsense 19 548 1 10
Genomic Location (Zv9):
Chromosome 7 (position 51322094)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49592330
GRCz11 7 49865106
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGCAAGTGGAGATCAGAATGCATGAGAATCATCTGGATCCTCTTCCA[G/T]AGCCTGAAGAGTCCATATGTGGAAGCTGCTGTGACAAACTCATGAAGAAC
Long Flanking Sequence:
ATCATGACATTTCCAGTAAACCTGGGTCTGCTGATGTGATCTATACACTATCTTCACATTCTTCTTAATTTCATCAGATCTTATTTTGGATTTTTATCACTGTGGCTATTGCTTTATATCAAATTTGAACTCTGAAAACACATTTTTAGTATCTGGAACTGCGTATTTTCATTCCATTCTGGTTCACGAACATTGATTGCATCAGTTAGATTAAAACTGCACTGTCATTCAGTGTTGTTGTGTCTGCAGCACATCATACACAAACATGTTTTTGTCACACGTACTGGAATACAACGGTTTGTATTGATGACAATGAATGGATTTTACTTGGTGGTTTACAGAAGCTTGTGTAAAATCACAACCAAAGCTGGTAGTGTATGCCAGATCATTTATATTGACATAGTTTACTGTATGCTTCGCTTTTGTTGTCCTCCAGTGCCAAGAAGATGCAGAAGCAAGTGGAGATCAGAATGCATGAGAATCATCTGGATCCTCTTCCA[G/T]AGCCTGAAGAGTCCATATGTGGAAGCTGCTGTGACAAACTCATGAAGAACCTGCTTCTAACGCTCACTGTTCTGGGCAAGTCTTTCTTCATGTTTGTATAATCAGTGTGTATTAGTTTGTTTTGTACTTAATAAATGTTGCTAACAGGCAAAAAACAAACAAACAAACAAACAAAAAAACTTATTACTGTTTGTGCTAAATTATGCACTTTTTAAATGATGTGTTATATGACACCACATTTAGGTTAACCATGCATTGTAAAACACTACTGTAAAATTTAAAGTATTACAGGCAGTTTTGGTTGCCATTAAAATTATACAGTCTACAAGTTCACTGTAAAATAACAATAACAATTGTTATTGTTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTGTAAACTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3646
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073932 Nonsense 199 548 4 10
Genomic Location (Zv9):
Chromosome 7 (position 51326901)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49597137
GRCz11 7 49869913
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTACTACTAAGGTGGAAATCGCTCCTCCTCCCCCTCCAACTCGGTTTGGA[C/T]GAAAYGCTACCAAGGGTGCAGCGAAATATGTGATCAAGAAATCTCTTCAG
Long Flanking Sequence:
GTCGTAACGCTTTGCTGTTGTTTATCATAATAGTTATTATTATTCTTATTTCTTTTAGGTTTAGCTGGCTTGGATGCCAAGTCGAGTGGCCGCCTGGGCACAAGGGCCATGATTTACTACATGTCCACCACTGTCATCGCAGCTGTGCTGGGGGTGATTCTGGTGCTCCTCATCCACCCTGGAAACCCCAAACTCAAGGCAAACCTGGGCGAGGGCAAAAAGAATGACGAAGTGTCCAGTTTAGATGCCTTCTTTGATCTCATCCGAAATCTGTTTCCAGAAAATCTCGTTCAGGCTTGTTTCCAGCAGGTTTGTGTTCCTAGAGTGCTTTGTTTTTTTATTTAATCTCATTCTTTAAACTTATTCTGTAAATTTTATAACAGTTAATGGTCTCTCGTTAATATTCAATGTCTTAATGATTCATATAAAATGTCTTTTAGATCCAGACTGTTACTACTAAGGTGGAAATCGCTCCTCCTCCCCCTCCAACTCGGTTTGGA[C/T]GAAACGCTACCAAGGGTGCAGCGAAATATGTGATCAAGAAATCTCTTCAGTTCAAGAGCGGCATGAATGTGTTAGGTATCAAATGGCTTCATGATATATGCATGAAAAGATCATTAACGTACATCGCATTAAGATGATGTGTTATGTGTTCTTGTAGGTATCATTGGTTTCTTTGTGGCATTTGGGATTTGCATGGGAAAGATGGGAGAGAAGGCCAAACTGATGGTTGATTTCTTCAACACTCTCAATGAGATCGTTATGAGGCTTGTCGGCATGATCATGTGGTCAGTATTCATGATTTTAATCCCATTGATCACATTTCATACTATTTTTTGACTGATTTATTTACTGTGCAGATAAAGTACACTGTAAAAAGCAATTAGTTGACTTTACTAAATAAAAACATGTCAACTAAATATGTCGCCTTATGATTATTAGGTAAACAAATTAAAAGTTAAGTCAATGTATGCCTTTTTGTAAGTCAAATTAATTTGTTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30892
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073932 Essential Splice Site 224 548 5 10
ENSDART00000073932 Essential Splice Site 224 548 5 10
Genomic Location (Zv9):
Chromosome 7 (position 51327058)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49597294
GRCz11 7 49870070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGATCATTAACGTACATCGCATTAAGATGATGTGTTATGTGTTCTTGTA[G/A]GTATCATTGGTTTCTTTGTGGCATTTGGGATTTGCATGGGAAAGATGGGA
Long Flanking Sequence:
TTCTGGTGCTCCTCATCCACCCTGGAAACCCCAAACTCAAGGCAAACCTGGGCGAGGGCAAAAAGAATGACGAAGTGTCCAGTTTAGATGCCTTCTTTGATCTCATCCGAAATCTGTTTCCAGAAAATCTCGTTCAGGCTTGTTTCCAGCAGGTTTGTGTTCCTAGAGTGCTTTGTTTTTTTATTTAATCTCATTCTTTAAACTTATTCTGTAAATTTTATAACAGTTAATGGTCTCTCGTTAATATTCAATGTCTTAATGATTCATATAAAATGTCTTTTAGATCCAGACTGTTACTACTAAGGTGGAAATCGCTCCTCCTCCCCCTCCAACTCGGTTTGGACGAAACGCTACCAAGGGTGCAGCGAAATATGTGATCAAGAAATCTCTTCAGTTCAAGAGCGGCATGAATGTGTTAGGTATCAAATGGCTTCATGATATATGCATGAAAAGATCATTAACGTACATCGCATTAAGATGATGTGTTATGTGTTCTTGTA[G/A]GTATCATTGGTTTCTTTGTGGCATTTGGGATTTGCATGGGAAAGATGGGAGAGAAGGCCAAACTGATGGTTGATTTCTTCAACACTCTCAATGAGATCGTTATGAGGCTTGTCGGCATGATCATGTGGTCAGTATTCATGATTTTAATCCCATTGATCACATTTCATACTATTTTTTGACTGATTTATTTACTGTGCAGATAAAGTACACTGTAAAAAGCAATTAGTTGACTTTACTAAATAAAAACATGTCAACTAAATATGTCGCCTTATGATTATTAGGTAAACAAATTAAAAGTTAAGTCAATGTATGCCTTTTTGTAAGTCAAATTAATTTGTTGCCTTTTAAGCAGCAAGTTTACTTCACTTTTTGGAGTGCATATAGTAGTCAACATTTCAAGTGGATCAACAAGTTCTAAAACTTTTAAACAACACTCATTACTACGGAGACCCGGAAAGGACATGAATGAGGTGGAAAAAATGGATGGGAGAAAAAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41004
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073932 Essential Splice Site 224 548 5 10
ENSDART00000073932 Essential Splice Site 224 548 5 10
Genomic Location (Zv9):
Chromosome 7 (position 51327058)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49597294
GRCz11 7 49870070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGATCATTAACGTACATCGCATTAAGATGATGTGTTATGTGTTCTTGTA[G/A]GTATCATTGGTTTCTTTGTGGCATTTGGGATTTGCATGGGAAAGATGGGA
Long Flanking Sequence:
TTCTGGTGCTCCTCATCCACCCTGGAAACCCCAAACTCAAGGCAAACCTGGGCGAGGGCAAAAAGAATGACGAAGTGTCCAGTTTAGATGCCTTCTTTGATCTCATCCGAAATCTGTTTCCAGAAAATCTCGTTCAGGCTTGTTTCCAGCAGGTTTGTGTTCCTAGAGTGCTTTGTTTTTTTATTTAATCTCATTCTTTAAACTTATTCTGTAAATTTTATAACAGTTAATGGTCTCTCGTTAATATTCAATGTCTTAATGATTCATATAAAATGTCTTTTAGATCCAGACTGTTACTACTAAGGTGGAAATCGCTCCTCCTCCCCCTCCAACTCGGTTTGGACGAAACGCTACCAAGGGTGCAGCGAAATATGTGATCAAGAAATCTCTTCAGTTCAAGAGCGGCATGAATGTGTTAGGTATCAAATGGCTTCATGATATATGCATGAAAAGATCATTAACGTACATCGCATTAAGATGATGTGTTATGTGTTCTTGTA[G/A]GTATCATTGGTTTCTTTGTGGCATTTGGGATTTGCATGGGAAAGATGGGAGAGAAGGCCAAACTGATGGTTGATTTCTTCAACACTCTCAATGAGATCGTTATGAGGCTTGTCGGCATGATCATGTGGTCAGTATTCATGATTTTAATCCCATTGATCACATTTCATACTATTTTTTGACTGATTTATTTACTGTGCAGATAAAGTACACTGTAAAAAGCAATTAGTTGACTTTACTAAATAAAAACATGTCAACTAAATATGTCGCCTTATGATTATTAGGTAAACAAATTAAAAGTTAAGTCAATGTATGCCTTTTTGTAAGTCAAATTAATTTGTTGCCTTTTAAGCAGCAAGTTTACTTCACTTTTTGGAGTGCATATAGTAGTCAACATTTCAAGTGGATCAACAAGTTCTAAAACTTTTAAACAACACTCATTACTACGGAGACCCGGAAAGGACATGAATGAGGTGGAAAAAATGGATGGGAGAAAAAAAAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
hu7909
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073932 Essential Splice Site 344 548 6 10
ENSDART00000073932 Essential Splice Site 344 548 6 10
Genomic Location (Zv9):
Chromosome 7 (position 51329922)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49600158
GRCz11 7 49872934
KASP Assay ID:
554-0636.1 (used for ordering genotyping assays)
KASP Sequence:
TCATGGGACTTTTYCNAGCTTGGGTCACCGCCTTAGGAACAGCTTCCAGG[T/C]TAGTCACTTTCCTTTAATTATGTTTTCCCTTAGATATTTGTATGACACAC
Long Flanking Sequence:
TTTAGGTTTAGATATTGGGTAGGACTAGAGATGTAGAATAAGATCATTCTTTATGAGTACTAATAAAAAGCCAGTATCATAATAATAAACATGTAATAAGCTAGCAGTTAATTGTGTGAATACTGAAACTAAGGTGTTCCCATTTCCTTGTGTAGTGTGTTTTTGTTTACTGTATTTGTTTCCTTTAACTTTATTAAACTGACCAACTATATTTCCTGTTGAAGGTGTAGTTTAGCTATTAATTTGTTTTTCTGTCCTGTCACAGGTATTCCCCCATTGGTATTGCGTGTTTGATCTGTGGGAAGATCATCTCCATTAATGATCTGGAAATGGTGGCCAAACAACTGGGCATGTACATGGTCACGGTCATCGTTGGACTCATTATTCATGGAGGCATATTTCTTCCCTTAATATATTTTGTAATCGTTCGGAAAAACCCATTCAAATTCTTCATGGGACTTTTCCAAGCTTGGGTCACCGCCTTAGGAACAGCTTCCAGG[T/C]TAGTCACTTTCCTTTAATTATGTTTTCCCTTAGATATTTGTATGACACACGTTGAACTAAAGAGTTTAGTTTGTTATGTTTGGTTGTGTCTCAATTTTTGATATGCAATTTTTGTAGTGCTGGCACATTACCTGTCACTTTCCGCTGCTTGGAAGAAAATCTGGGTATCGACAAGAGAGTGACGCGATTCGTGTTACCTGTTGGAGCAACCATCAACATGGACGGTACTGCACTTTATGAGGCCGTAGCTGCCATTTTTATTGCCCAGATGAATGGAATCGAACTTGATCCTGGTCAGATCGTGACAGTCAGGTAAGAGCAAATTTCTAGACAAAAAAAATAAACAATTTAGTATAAATTTACAATACATTGTTTGTACCACAACATTATTTTTGTTGCTCATTCATTGCTCATGCTCATTGTAAACACTGCCAACACATGCTTCAGTCCAACTTCTATATACTACACTCTCAGAAATAAAAGTATGCAAGCTTTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa729
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073932 Essential Splice Site 344 548 6 10
ENSDART00000073932 Essential Splice Site 344 548 6 10
Genomic Location (Zv9):
Chromosome 7 (position 51329922)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49600158
GRCz11 7 49872934
KASP Assay ID:
554-0636.1 (used for ordering genotyping assays)
KASP Sequence:
TCATGGGACTTTTCCAAGCTTGGGTCACCGCCTTAGGAACAGCTTCCAGG[T/C]TAGTCACTTTCCTTTAATTATGTTTTCCCTTAGATATTTGTATGACACAC
Long Flanking Sequence:
TTTAGGTTTAGATATTGGGTAGGACTAGAGATGTAGAATAAGATCATTCTTTATGAGTACTAATAAAAAGCCAGTATCATAATAATAAACATGTAATAAGCTAGCAGTTAATTGTGTGAATACTGAAACTAAGGTGTTCCCATTTCCTTGTGTAGTGTGTTTTTGTTTACTGTATTTGTTTCCTTTAACTTTATTAAACTGACCAACTATATTTCCTGTTGAAGGTGTAGTTTAGCTATTAATTTGTTTTTCTGTCCTGTCACAGGTATTCCCCCATTGGTATTGCGTGTTTGATCTGTGGGAAGATCATCTCCATTAATGATCTGGAAATGGTGGCCAAACAACTGGGCATGTACATGGTCACGGTCATCGTTGGACTCATTATTCATGGAGGCATATTTCTTCCCTTAATATATTTTGTAATCGTTCGGAAAAACCCATTCAAATTCTTCATGGGACTTTTCCAAGCTTGGGTCACCGCCTTAGGAACAGCTTCCAGG[T/C]TAGTCACTTTCCTTTAATTATGTTTTCCCTTAGATATTTGTATGACACACGTTGAACTAAAGAGTTTAGTTTGTTATGTTTGGTTGTGTCTCAATTTTTGATATGCAATTTTTGTAGTGCTGGCACATTACCTGTCACTTTCCGCTGCTTGGAAGAAAATCTGGGTATCGACAAGAGAGTGACGCGATTCGTGTTACCTGTTGGAGCAACCATCAACATGGACGGTACTGCACTTTATGAGGCCGTAGCTGCCATTTTTATTGCCCAGATGAATGGAATCGAACTTGATCCTGGTCAGATCGTGACAGTCAGGTAAGAGCAAATTTCTAGACAAAAAAAATAAACAATTTAGTATAAATTTACAATACATTGTTTGTACCACAACATTATTTTTGTTGCTCATTCATTGCTCATGCTCATTGTAAACACTGCCAACACATGCTTCAGTCCAACTTCTATATACTACACTCTCAGAAATAAAAGTATGCAAGCTTTCACTG
Associated Phenotype:
Not determined