Busch Lab

ZMP

rag1

Ensembl ID:
ENSDARG00000052122
ZFIN ID:
ZDB-GENE-990415-234
Description:
V(D)J recombination-activating protein 1Endonuclease RAG1E3 ubiquitin-protein ligase RAG1 [Source:Un
Human Orthologue:
RAG1
Human Description:
recombination activating gene 1 [Source:HGNC Symbol;Acc:9831]
Mouse Orthologue:
Rag1
Mouse Description:
recombination activating gene 1 Gene [Source:MGI Symbol;Acc:MGI:97848]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32518 Nonsense Available for shipment Available now
hu1999 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa32518
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073913 Nonsense 790 1057 3 3
ENSDART00000142917 Nonsense 790 1057 4 4
Genomic Location (Zv9):
Chromosome 25 (position 9236192)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8930855
GRCz11 25 9007923
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAAATCTCGAGCGCTATGAGATCTGGAGGAAAAATCCCTTCTCAGAGT[C/A]AGCAGACGAACTGCGTGACCGAGTCAAAGGTGTTTCTGCTAAGCCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu1999
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073913 Nonsense 797 1057 3 3
ENSDART00000142917 Nonsense 797 1057 4 4
Genomic Location (Zv9):
Chromosome 25 (position 9236212)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8930875
GRCz11 25 9007943
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTCGAGCGCTATGAGATCTGGAGGAAAAATCCCTTCTCAGAGTCAGCAGACGAACTGCGTGAC[C/T]GAGTCAAAGGTGTTTCTGCTAAGCCTTTCATGGAAACCCAGCCTACTCTGGATGCACTGCACTGTGATATTGGCAATGCGACTGAATTCTACAAAATCTTTCAGG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5097
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073913 Nonsense 922 1057 3 3
ENSDART00000142917 Nonsense 922 1057 4 4
Genomic Location (Zv9):
Chromosome 25 (position 9236587)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8931250
GRCz11 25 9008318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGACCTCTACTTGCAGATGAAGCCTGTATGGCGGTCAACTTGTCCCTCC[A/T]GAGACTGCCCTGACCAACTCTGTCAATACAGCTACAACTCTCAGCAATTT
Associated Phenotype:
Not determined