Busch Lab

ZMP

CRTC3

Ensembl ID:
ENSDARG00000052114
Description:
CREB regulated transcription coactivator 3 [Source:HGNC Symbol;Acc:26148]
Human Orthologue:
CRTC3
Human Description:
CREB regulated transcription coactivator 3 [Source:HGNC Symbol;Acc:26148]
Mouse Orthologue:
Crtc3
Mouse Description:
CREB regulated transcription coactivator 3 Gene [Source:MGI Symbol;Acc:MGI:1917711]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa41008 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9161 Nonsense Mutation detected in F1 DNA Not yet available
sa5443 Nonsense F2 line generated Not yet available
sa8737 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41008
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073903 Essential Splice Site 223 631 7 15
Genomic Location (Zv9):
Chromosome 7 (position 52023141)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50293377
GRCz11 7 50566153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTGGTGTGAATAAGCCAATGCCCAAACAACTATGGGAAGCCAAAAAG[G/A]TTGGTGCATGGGTACTTTGATTAATTGCAAAAAAAAGTAGTATTGATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9161
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073903 Nonsense 387 631 10 15
Genomic Location (Zv9):
Chromosome 7 (position 52019749)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50289985
GRCz11 7 50562761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCCCCTGACGCTCTCTCCAGGGGGAGATCAGAGGAGAAGCCTGAGCAAA[C/T]AGCTCTCGCCGACAATGTCGCCCTCTCTGTCTCCAATCACACAGGTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5443
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073903 Nonsense 428 631 11 15
Genomic Location (Zv9):
Chromosome 7 (position 52018132)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50288368
GRCz11 7 50561144
KASP Assay ID:
554-3503.1 (used for ordering genotyping assays)
KASP Sequence:
CAATGGAGCCTCCTCCTCCTTACCCTCTTTACCAGCAAAGCCAGCAGCCA[C/T]AGCCTCCACAGTCCCATCAGGCCATTCAGCAGAGCTCCCAGCATCCAGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27046
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073903 Essential Splice Site 450 631 12 15
Genomic Location (Zv9):
Chromosome 7 (position 52018016)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50288252
GRCz11 7 50561028
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGGTGGACAACAACAACAACAACAACAACAGCAGCAACAGCAGCACCA[C/G]CAGCCTGTGTCCCCGCTGCAGAACATCCAGCTGGACTTCAACTCCAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8737
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073903 Nonsense 494 631 13 15
Genomic Location (Zv9):
Chromosome 7 (position 52008798)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50279034
GRCz11 7 50551810
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CWTTTATGGAGCAGCAGTTCTCTGGACGTCAGTCAAAATGTTCAGCCTAT[C/T]AGGTAAACGTGCCTTTAGGGCAYTCCAAAGTTGACCCTCTTTTCCARACT
Associated Phenotype:
Not determined