Busch Lab

ZMP

agxta

Ensembl ID:
ENSDARG00000052099
ZFIN ID:
ZDB-GENE-040718-16
Description:
alanine-glyoxylate aminotransferase a [Source:RefSeq peptide;Acc:NP_001002331]
Human Orthologue:
AGXT
Human Description:
alanine-glyoxylate aminotransferase [Source:HGNC Symbol;Acc:341]
Mouse Orthologue:
Agxt
Mouse Description:
alanine-glyoxylate aminotransferase Gene [Source:MGI Symbol;Acc:MGI:1329033]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa7041 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa26748 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33871 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7041
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073881 Essential Splice Site 54 391 2 11
Genomic Location (Zv9):
Chromosome 6 (position 26827474)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27128685
GRCz11 6 27119246
KASP Assay ID:
554-5323.1 (used for ordering genotyping assays)
KASP Sequence:
GGAAATAAAATGAGACTGTTTTATTAATAATTCGTTCTGATTTTGCTTTC[A/G]GATTATGAATCAGATAAAGAGCGGCATTCAGTATGCGTTTCAAACCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26748
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073881 Essential Splice Site 196 391 5 11
Genomic Location (Zv9):
Chromosome 6 (position 26824123)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27125334
GRCz11 6 27115895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTCAGTAGCAGCATTGGGAGGTGCTCCTATCTGTATGGATGAACAAG[G/A]TATCGTCACACTTTATTCTGTGGTAGCACAATCCTTAACTTTGGTCCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33871
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073881 Essential Splice Site 225 391 7 11
Genomic Location (Zv9):
Chromosome 6 (position 26823874)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27125085
GRCz11 6 27115646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATATCTCATACTTAAATATCTTACATCTTTTTTTTTGTTTTGGAAAAC[A/G]GCCACAAAATATTTAATAGGAAAACAAAACCAATCTCTTACTTCTTGGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26747
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073881 Essential Splice Site 225 391 7 11
Genomic Location (Zv9):
Chromosome 6 (position 26823873)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27125084
GRCz11 6 27115645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATATCTCATACTTAAATATCTTACATCTTTTTTTTTGTTTTGGAAAACA[G/T]CCACAAAATATTTAATAGGAAAACAAAACCAATCTCTTACTTCTTGGACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2341
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073881 Nonsense 232 391 7 11
Genomic Location (Zv9):
Chromosome 6 (position 26823853)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27125064
GRCz11 6 27115625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTACATCTTTTTTTNNNTTGTTTTGGAAAACAGCCACAAAATATTTAATAGG[A/T]AAACAAAACCAATCTCTTACTTCTTGGACTTRAACTGGTTGGCRAATTAT
Associated Phenotype:
Not determined