Busch Lab

ZMP

zgc:174928

Ensembl ID:
ENSDARG00000052086
ZFIN ID:
ZDB-GENE-080220-14
Description:
hypothetical protein LOC792701 [Source:RefSeq peptide;Acc:NP_001107099]
Human Orthologue:
ZNF473
Human Description:
zinc finger protein 473 [Source:HGNC Symbol;Acc:23239]
Mouse Orthologue:
Zfp473
Mouse Description:
zinc finger protein 473 Gene [Source:MGI Symbol;Acc:MGI:2442697]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25708 Nonsense Mutation detected in F1 DNA Not yet available
sa19631 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25709
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073833 None None 524 None 4
ENSDART00000073836 None None 491 None 7
ENSDART00000073862 None None 346 None 2
ENSDART00000127718 Essential Splice Site 159 650 1 3
ENSDART00000127941 None None 174 None 4
Genomic Location (Zv9):
Chromosome 1 (position 59184239)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57870467
GRCz11 1 58606149
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATACCGGAGAGAAACCGTACCGCTGCTCCATCTGCGAAGAGAGGTTTGC[G/A]TATTTAGGAAGTTTTCAGAGCCACCAGAAGAAACATGGAGGAGAACTAGT
Long Flanking Sequence:
AAACCCCACATGAAGAACCACATCCGCATTCACACCAAAGAGAGGCCGTACCAGTGCAGCGAGTGCGGAAAAACCTTTGGAAACATGACCTCTCTAAGGTCACATCTAAAAATACACTCTGAGGAAAAACCGCATCAGTGCAAACACTGCGACAAGCGATTCCGGCAGAAGTCAGCTTTGACTTCTCATGAAAAGACTCACAGTGGAGAGAAACCGTACCTGTGCGCTGAATGCGGGATGAGGTTTTATATTCAAGCTCAAATGGTTTATCACCAAAGAATCCACACTGGAGAGAAACCGTACCTGTGCAACATCTGTGGCCGGAGTTTCAACAAACCAGGCATCTTAATAAACCACATGAGGACTCACACTGGAGAAAGACCCTATAAGTGTTCACACTGCGACAAGACGTTTGCACGATCTGACGTGCTGAAGACCCACGAGAGGGTTCATACCGGAGAGAAACCGTACCGCTGCTCCATCTGCGAAGAGAGGTTTGC[G/A]TATTTAGGAAGTTTTCAGAGCCACCAGAAGAAACATGGAGGAGAACTAGTGGATGCGCAGATCAGCGCATGATGGAGAATTGACGACTGAGTGTTTCTGGCAGCGTTTTTCAATCCTAGTCCTCACTCTCCACTGCTTTTCATGTTTTGATATTTTAAAAAGAAGTTAATATTATATACCAGTAGTCAGTGACTTCCATAATAGGCCTACAGCGTCTCATAAACACAGCACTCATGTGAGAGGTGCTGCAAAGCATGTGAGCATAACAGTCACGTGCATTAAGCGCTTACATAGAAAAACAATGGGAAAGTGGTACACTGGAATGGAGAAGCGTGTTCTTTGTCAATGGCTAATAAGTCATCGAAATATTGTAATGTGCGATATTATATTGCCACATTCAAATAAAGCTTTAAATATAAAAATGATACCACATTCTAATAAAACATTTTACATGACTAAATGTCATTAAGCAAAGAAGTATATGAAGAGTTCAGATGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25708
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073833 None None 524 None 4
ENSDART00000073836 Nonsense 329 491 7 7
ENSDART00000073862 Nonsense 173 346 2 2
ENSDART00000127718 Nonsense 487 650 3 3
ENSDART00000127941 None None 174 None 4
Genomic Location (Zv9):
Chromosome 1 (position 59172527)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57882179
GRCz11 1 58617861
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATCCTACATGAAGAACCACATCCGCATTCACACCAACGAGAGGCCGTA[C/A]CAGTGCAGCGAGTGCGGAAAAACCTTCAAAACAAACAACTCTCTAAACTC
Long Flanking Sequence:
CTTTCAGGTGACAACACTGGATCGTCTGATGAAGAAGCGCCGTTAACTTTGAAAGGTAAGCCGAAGGTCAAGAAGAGTTTCTCCTGCACCTCCTGTGGAAAAGCATTCGCCTGTCAAAGTTATTTATTGATTCATGAAAGAAAACACTCAGAACCGAAGGTCTTCATCTGCTGGAGATGTCGTAAGTGCTTTCCAACATTACAGGAGAGAAAACTTCACCTGAAAGAGCATCTGGCAGAAAAGGAGTTCCACTGTGAACAGTGCGGGAAGAACTTTTTATTGTCTAATCAGCTAAAAGTTCACATGAAGACGCACAGCGGTGACCAGCGTGTCCAGTGTGACGTATGCAACAAATCATTCAGCACCAAAGCAAACCTGGAGGTTCATAAGAGAATCCACACGGGCGAGCGGCCGTATAAATGCCCTCACTGCAAGAAGAGCTTTAATTACAAATCCTACATGAAGAACCACATCCGCATTCACACCAACGAGAGGCCGTA[C/A]CAGTGCAGCGAGTGCGGAAAAACCTTCAAAACAAACAACTCTCTAAACTCTCATCTAAAATTCCACTCTGAGGAAAAACCGCATCAGTGCAAATACTGCGACAAGCGATTCCGCATGAAAGCAAATCTGAATGTCCATGAGAGGATTCACACCGGAGAGAAGCCGTACCTGTGCGCCGAATGCGGGAAGAGGGTTAAAACTTCTACTGAGCTGGTTTGTCACCAAAGAATCCACACTGGAGAAAAACCGTACCTGTGCAACATATGTGGGCGGAGTTTCAGTAAACCAACCATCTTAATAAACCACATGAGGACTCACACTGGAGAAAGACCCTATAAATGTTCACACTGCGACAAGACGTTTGCACGATCTGACGTGCTGAAGACCCACGAGAGGGTTCATACCGGAGAGAAACCGTACCGCTGCTCCATCTGCGAAGAGAGGTTTGCGTATTTAGGAAGTTTTCAGAGCCACCAGAAGAAACATGGAGCAGAACTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19631
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073833 None None 524 None 4
ENSDART00000073836 Nonsense 452 491 7 7
ENSDART00000073862 Nonsense 296 346 2 2
ENSDART00000127718 Nonsense 610 650 3 3
ENSDART00000127941 None None 174 None 4
Genomic Location (Zv9):
Chromosome 1 (position 59172160)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57882546
GRCz11 1 58618228
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGGAGAAAGACCCTATAAATGTTCACACTGCGACAAGACGTTTGCA[C/T]GATCTGACGTGCTGAAGACCCACGAGAGGGTTCATACCGGAGAGAAACCG
Long Flanking Sequence:
AAGCAAACCTGGAGGTTCATAAGAGAATCCACACGGGCGAGCGGCCGTATAAATGCCCTCACTGCAAGAAGAGCTTTAATTACAAATCCTACATGAAGAACCACATCCGCATTCACACCAACGAGAGGCCGTACCAGTGCAGCGAGTGCGGAAAAACCTTCAAAACAAACAACTCTCTAAACTCTCATCTAAAATTCCACTCTGAGGAAAAACCGCATCAGTGCAAATACTGCGACAAGCGATTCCGCATGAAAGCAAATCTGAATGTCCATGAGAGGATTCACACCGGAGAGAAGCCGTACCTGTGCGCCGAATGCGGGAAGAGGGTTAAAACTTCTACTGAGCTGGTTTGTCACCAAAGAATCCACACTGGAGAAAAACCGTACCTGTGCAACATATGTGGGCGGAGTTTCAGTAAACCAACCATCTTAATAAACCACATGAGGACTCACACTGGAGAAAGACCCTATAAATGTTCACACTGCGACAAGACGTTTGCA[C/T]GATCTGACGTGCTGAAGACCCACGAGAGGGTTCATACCGGAGAGAAACCGTACCGCTGCTCCATCTGCGAAGAGAGGTTTGCGTATTTAGGAAGTTTTCAGAGCCACCAGAAGAAACATGGAGCAGAACTAGTGGATGCGCAGATCAGCGCATGATGGAGAATTGACGACTGAGTGTTTCTGACAGCGTTTCTTCATCCTAGTCCTCAATCTCCACTGCTCTGCGTATTTTGATATTTGGAAAAGAAGTTAAAATTGTGCACTGCTAGCTATTGACTTCCATAGTACGTTGTCATCAAAACAGTGCTGATGTGAAAGATGCTGCAAAACGCATAAGCGTAATGGTCATGTCCATTAACTGCGTGTCTACCTAGAGAAACAATGAAAAAGTAGCTCACTAGAATGGACAAACCTGTTCTTTGCGATATTATATTACCATATTAAAATACACCTTTAAAAATAAAATTTATAAATCAAAAACTAAGTGTCATAAATTAAACA
Associated Phenotype:
Not determined