Busch Lab

ZMP

PAQR9

Ensembl ID:
ENSDARG00000052059
Description:
progestin and adipoQ receptor family member IX [Source:HGNC Symbol;Acc:30131]
Human Orthologue:
PAQR9
Human Description:
progestin and adipoQ receptor family member IX [Source:HGNC Symbol;Acc:30131]
Mouse Orthologue:
Paqr9
Mouse Description:
progestin and adipoQ receptor family member IX Gene [Source:MGI Symbol;Acc:MGI:1922802]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34179 Nonsense Mutation detected in F1 DNA Not yet available
sa41013 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34179
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073815 Nonsense 154 306 2 3
Genomic Location (Zv9):
Chromosome 7 (position 52337071)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50606821
GRCz11 7 50881891
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATTCGAGAAATTTGTTTTTTTGTGGACTACGGGACTATCAGTGCATA[T/A]ACAGTGGGTTCCTCATTGGCGTATTTCTACTACATCCATCCTCAAGCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41013
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073815 Nonsense 183 306 3 3
Genomic Location (Zv9):
Chromosome 7 (position 52336882)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50606632
GRCz11 7 50881702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCACACAGGTCCAGCTGTTCTTTGAAAGCCTCTACATCCCATCCACCTG[T/A]CTGGTTGCCATCATTTGCGTCCTCACCTGCTGCAACACCAGACAGCGTTG
Associated Phenotype:
Not determined