Busch Lab

ZMP

zgc:194993

Ensembl ID:
ENSDARG00000052057
ZFIN ID:
ZDB-GENE-080722-44
Description:
procollagen C-endopeptidase enhancer-like [Source:RefSeq peptide;Acc:NP_001122259]
Human Orthologue:
PCOLCE
Human Description:
procollagen C-endopeptidase enhancer [Source:HGNC Symbol;Acc:8738]
Mouse Orthologue:
Pcolce
Mouse Description:
procollagen C-endopeptidase enhancer protein Gene [Source:MGI Symbol;Acc:MGI:105099]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa21067 Nonsense Available for shipment Available now
sa1147 Nonsense Available for shipment Available now
sa21068 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21067
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073806 Nonsense 90 538 3 9
Genomic Location (Zv9):
Chromosome 7 (position 52313698)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50583448
GRCz11 7 50858518
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTCCAGTTCAGGATCTTCGATCTAGAGGCAGATCCCACCTGCCGCTA[T/A]GACTATGTGGATGTCTATAATGGACACTCATACACAGTGCAGAAACTGGG
Long Flanking Sequence:
TTAAGTTAAGTGGTTGTAAACAATTAATTTAGGCTGAATTTAAACAAATAAATTAAGTTGAATTACTAAATTTAATTTGTTTAAATCCAACCCATATAAATTGTTTGCAACAATTTTGAAGAAATATATATTTTTCTGTGTATGTTCAACATCATTTGGGAAAAAATTGAAACAATAACAGGAGGATCAATAATTTTGACTTAAACCGTATTTTCCTTTCATTTCTCTCTCCTGCTCTCTAGGCCCGTATTCCTGTGTGGTGGACATCTGGTGACCGACTCAGGATTTGTGGCCAGTGAGGGTTTTCCCTCTCACTATAAAGCAAACTCCAAATGCACCTGGTACATCACAGTGAGTCCATCACCTTCAGTTTTCAGTTTCTCTTATCTACTATTTTCCACATTTTCATCCAATCTCCACTCCTATCAGGTCCCAGAAGGTCATGTTGTGATGCTCCAGTTCAGGATCTTCGATCTAGAGGCAGATCCCACCTGCCGCTA[T/A]GACTATGTGGATGTCTATAATGGACACTCATACACAGTGCAGAAACTGGGTCGCTTCTGTGGGACATTCAGACCCGGAGCCCTGATCTCCACCTCTAACACCATGATGCTGGAGATGGCATCTGACAGTAGCACAGGAGGAAGAGGATTCCTGGCGTATTTTAGTGGAGGCAAACCACATGTTGATGGTAAGCTGACTTCACGCTTTGCCTTTAATATCAATCCACACTAAAATAGCTAATAGACTGTACCAACTGTTATCAAGTTATCAGCTTTTTGATGTGATGGTTCACTGTAAAAAAAATCGTGGTGCCTTAAATATTTTAACTGAGTCCAATTATGCAGCAGAGTGGCTCAGTGGTTAACACTGTCACCTCACAGCAAGAAGGTTTCTGGTTCGATCCTTGACTGGGCCAGTTGGTCTTTCTGTGTGAAGTTTGCATGTTCTCCTCATGTTGGCGTGAGTTTCCTCTGGGTGCTCCACAGTTCAATGACATGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1147
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073806 Nonsense 114 538 3 9
Genomic Location (Zv9):
Chromosome 7 (position 52313768)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50583518
GRCz11 7 50858588
KASP Assay ID:
554-1058.1 (used for ordering genotyping assays)
KASP Sequence:
ATGGACACTCATACACAGTGCAGAAACTGGGYCGCTTCTGTGGKACATTC[A/T]GACCCGGAGCCCTGATCTCCACCTCTAACACCATGATGCTGGAGATGGCA
Long Flanking Sequence:
TTTAATTTGTTTAAATCCAACCCATATAAATTGTTTGCAACAATTTTGAAGAAATATATATTTTTCTGTGTATGTTCAACATCATTTGGGAAAAAATTGAAACAATAACAGGAGGATCAATAATTTTGACTTAAACCGTATTTTCCTTTCATTTCTCTCTCCTGCTCTCTAGGCCCGTATTCCTGTGTGGTGGACATCTGGTGACCGACTCAGGATTTGTGGCCAGTGAGGGTTTTCCCTCTCACTATAAAGCAAACTCCAAATGCACCTGGTACATCACAGTGAGTCCATCACCTTCAGTTTTCAGTTTCTCTTATCTACTATTTTCCACATTTTCATCCAATCTCCACTCCTATCAGGTCCCAGAAGGTCATGTTGTGATGCTCCAGTTCAGGATCTTCGATCTAGAGGCAGATCCCACCTGCCGCTATGACTATGTGGATGTCTATAATGGACACTCATACACAGTGCAGAAACTGGGTCGCTTCTGTGGGACATTC[A/T]GACCCGGAGCCCTGATCTCCACCTCTAACACCATGATGCTGGAGATGGCATCTGACAGTAGCACAGGAGGAAGAGGATTCCTGGCGTATTTTAGTGGAGGCAAACCACATGTTGATGGTAAGCTGACTTCACGCTTTGCCTTTAATATCAATCCACACTAAAATAGCTAATAGACTGTACCAACTGTTATCAAGTTATCAGCTTTTTGATGTGATGGTTCACTGTAAAAAAAATCGTGGTGCCTTAAATATTTTAACTGAGTCCAATTATGCAGCAGAGTGGCTCAGTGGTTAACACTGTCACCTCACAGCAAGAAGGTTTCTGGTTCGATCCTTGACTGGGCCAGTTGGTCTTTCTGTGTGAAGTTTGCATGTTCTCCTCATGTTGGCGTGAGTTTCCTCTGGGTGCTCCACAGTTCAATGACATGCGCTCTATGTAAATTAGTCGTAGTGTATGAGTGTGAATGCGAGAGTCTATGGGTGTTTCCCAGTACTGGGTTG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5444
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073806 Nonsense 340 538 6 9
Genomic Location (Zv9):
Chromosome 7 (position 52319536)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50589286
GRCz11 7 50864356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCAACACCTAAAACCAGMTCCAATCCTGCAGCCAAACCTAAACCTGTC[A/T]GACCTACTCCACCTACAAGAAGATCTGGGTCAAAAATCACACCAAAACCT
Long Flanking Sequence:
TTTAAAAATATGATAGTTTACTGTATGTTATAAACCACTAAACTATTTTCAGGTATTTAACCAACTACCCATTCAAAACATCTAGATCTTGGCACAATGGGATTGAAAGTAGTTCCCATTTATACCTATTTAAAAATTTTGCATATCTGTATACGCTATGTGCTGTTCAGTGTTTTAATAAAGCTCTTGATATGTCTGCCAGTGCGGTTGTGACCAATGGAAATGAGCTGCTAGTGCACTTTGTATCAGATCTGAGTGTGACGGCTGCAGGCTTCATGGCTCACTATAGGAGTGTTCCCCGTGGCTCCCGCACACCCACCGCTGACTTGGACACAGTACATGGGCCACGGGTCAACACTTCCCCAACTAAACCCACAGTCCCACCACAGAGAGTGAAACCAAAGCCAACACCAAAACCTCCATCAAGACCATTTAAACCTGTACCACCACGACCAACACCTAAAACCAGATCCAATCCTGCAGCCAAACCTAAACCTGTC[A/T]GACCTACTCCACCTACAAGAAGATCTGGGTCAAAAATCACACCAAAACCTGCGGTGAAAGTGACAGCAAAGCCGGCGACGAAGCCTACACCTAAACCCGCCATTAGACCTCAACCAAAACCAACAAGTACAACAGCAAAGCAAGAAGTAAAGCCTGGAGTCAAACCAACAGCAAAGACCATCTCAAAACCTGGCAACAGAACAACATCAAGAACAGGTAAGCTAAAATAAGACCTATTTAGTTCAACTAACTCAAGTTTTTGACTTGTCTTTTTATTAAATTAACGTAACGTATTTAACGTATGATTAAACTAATTTTGTACTAGTTTGTATATTTCTAGCCCTAATAATGAGACAAATTTGCCAGAGATGGGTTGCGGCTGGAAGGGCATCCGCTGCGTAAAAACGTGCTGGATAAGTTGGGGGTTCATTCCGTGGCGACCCCATGTTAATAAAGGGACTAAGCCGACAAGAAAATGAATGAATGAATAAATGAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21068
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073806 Nonsense 387 538 6 9
Genomic Location (Zv9):
Chromosome 7 (position 52319677)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50589427
GRCz11 7 50864497
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAAACCCGCCATTAGACCTCAACCAAAACCAACAAGTACAACAGCAAAG[C/T]AAGAAGTAAAGCCTGGAGTCAAACCAACAGCAAAGACCATCTCAAAACCT
Long Flanking Sequence:
CATATCTGTATACGCTATGTGCTGTTCAGTGTTTTAATAAAGCTCTTGATATGTCTGCCAGTGCGGTTGTGACCAATGGAAATGAGCTGCTAGTGCACTTTGTATCAGATCTGAGTGTGACGGCTGCAGGCTTCATGGCTCACTATAGGAGTGTTCCCCGTGGCTCCCGCACACCCACCGCTGACTTGGACACAGTACATGGGCCACGGGTCAACACTTCCCCAACTAAACCCACAGTCCCACCACAGAGAGTGAAACCAAAGCCAACACCAAAACCTCCATCAAGACCATTTAAACCTGTACCACCACGACCAACACCTAAAACCAGATCCAATCCTGCAGCCAAACCTAAACCTGTCAGACCTACTCCACCTACAAGAAGATCTGGGTCAAAAATCACACCAAAACCTGCGGTGAAAGTGACAGCAAAGCCGGCGACGAAGCCTACACCTAAACCCGCCATTAGACCTCAACCAAAACCAACAAGTACAACAGCAAAG[C/T]AAGAAGTAAAGCCTGGAGTCAAACCAACAGCAAAGACCATCTCAAAACCTGGCAACAGAACAACATCAAGAACAGGTAAGCTAAAATAAGACCTATTTAGTTCAACTAACTCAAGTTTTTGACTTGTCTTTTTATTAAATTAACGTAACGTATTTAACGTATGATTAAACTAATTTTGTACTAGTTTGTATATTTCTAGCCCTAATAATGAGACAAATTTGCCAGAGATGGGTTGCGGCTGGAAGGGCATCCGCTGCGTAAAAACGTGCTGGATAAGTTGGGGGTTCATTCCGTGGCGACCCCATGTTAATAAAGGGACTAAGCCGACAAGAAAATGAATGAATGAATAAATGAATCAAACAAAGTGCACAATTAACGTTAAATGAAGGATTATTTTTATATCATGTTAAAATATGGTAAAAATTATATGAAAAAAAGTAATTAAAAATTTTTTTTTACATTAACTTTATTACATTAATCAGATTTCAGCTAAATTTGTT
Associated Phenotype:
Not determined