Busch Lab

ZMP

im:7147241

Ensembl ID:
ENSDARG00000052046
ZFIN ID:
ZDB-GENE-050208-274
Description:
Im:7147241 protein [Source:UniProtKB/TrEMBL;Acc:Q56A51]
Human Orthologue:
SEC16B
Human Description:
SEC16 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:30301]
Mouse Orthologue:
Sec16b
Mouse Description:
SEC16 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2148802]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa25333 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15923 Nonsense Available for shipment Available now
sa18286 Nonsense Available for shipment Available now
sa20682 Essential Splice Site Available for shipment Available now
sa145 Nonsense Available for shipment Available now
sa33845 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33844 Nonsense Mutation detected in F1 DNA Not yet available
sa26728 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25333
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Essential Splice Site 156 935 3 24
Genomic Location (Zv9):
Chromosome 6 (position 20071218)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23827957
GRCz11 6 23927766
KASP Assay ID:
554-7339.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGACTGACGCAGGAGTCTGCAAGAGCTTCATACTCCGATCAGCAGGGG[T/A]CTGTCAATGACTTGTTCTCATACGCTAATACTGTCAATCTAATGATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15923
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Nonsense 216 935 5 24
Genomic Location (Zv9):
Chromosome 6 (position 20067527)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23824266
GRCz11 6 23924075
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTGTCTTCAAGCAGCTATGAGCTCAGTCAGTATATGAATGGAGCTGAA[C/T]AGAGTGAGCTWGAGCTCAKTTCTCACACAGGTTTGTCAGAACCACAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18286
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Nonsense 492 935 12 24
Genomic Location (Zv9):
Chromosome 6 (position 20052755)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23809494
GRCz11 6 23909303
KASP Assay ID:
2259-7425.1 (used for ordering genotyping assays)
KASP Sequence:
ATATTWCYGTATTTCTTWGCAGTCCTGGAGTAGTGAGAAGTGGGGAGACT[G/A]GCGAYCACACYTGGCTGTTATGCTGTCCAATGAGACAACRGACCCTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20682
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Essential Splice Site 522 935 13 24
Genomic Location (Zv9):
Chromosome 6 (position 20052579)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23809318
GRCz11 6 23909127
KASP Assay ID:
2259-7424.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAATTAAATAATTAATGAAGAGTTTTTTACTCTAATGTTTTCATCTCA[G/A]CCTCCAGGGATATGCTGTTTGCTTCACACATTTGCTACCTCACGGCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa145
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Nonsense 596 935 15 24
Genomic Location (Zv9):
Chromosome 6 (position 20047686)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23804425
GRCz11 6 23904234
KASP Assay ID:
554-0037.1 (used for ordering genotyping assays)
KASP Sequence:
TCTGTTATCTATTGCATATTTATTCATCTGTTGTTTTCCATKTAGGTGTA[T/A]AAATTCCTGTATGCATGCCGGCTGCTGGACTGTGGGCTCGTTTCTCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33845
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Essential Splice Site 641 935 16 24
Genomic Location (Zv9):
Chromosome 6 (position 20047430)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23804169
GRCz11 6 23903978
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAATGCCACTTCCAGCATGTTCAGTCTGTCTGTTTTGTTTGCTACAACA[G/T]TTGGTGGATAGACTGAAGTTCTCCGAAGCACAGCTCAATGACACGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33844
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Nonsense 649 935 16 24
Genomic Location (Zv9):
Chromosome 6 (position 20047405)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23804144
GRCz11 6 23903953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTCTGTTTTGTTTGCTACAACAGTTGGTGGATAGACTGAAGTTCTCC[G/T]AAGCACAGCTCAATGACACGTGTGACGGTCAGCTTTTCCTGGACCCCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26728
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Nonsense 869 935 21 24
Genomic Location (Zv9):
Chromosome 6 (position 20043792)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23800531
GRCz11 6 23900340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATATTGTTTCATGAACAGGCCTCAAAGCCCGGATGGTTCAGTGGCTG[G/A]TTCAAATCTAAGCCTAAAGAGGAACCAAAAGAAGACATCCCAGACCCTGA
Associated Phenotype:
Not determined